Skip site navigation (1)Skip section navigation (2)

FreeBSD Manual Pages

  
 
  

home | help
PERLRETUT(1)	       Perl Programmers	Reference Guide		  PERLRETUT(1)

NAME
       perlretut - Perl	regular	expressions tutorial

DESCRIPTION
       This page provides a basic tutorial on understanding, creating and
       using regular expressions in Perl.  It serves as	a complement to	the
       reference page on regular expressions perlre.  Regular expressions are
       an integral part	of the "m//", "s///", "qr//" and "split" operators and
       so this tutorial	also overlaps with "Regexp Quote-Like Operators" in
       perlop and "split" in perlfunc.

       Perl is widely renowned for excellence in text processing, and regular
       expressions are one of the big factors behind this fame.	 Perl regular
       expressions display an efficiency and flexibility unknown in most other
       computer	languages.  Mastering even the basics of regular expressions
       will allow you to manipulate text with surprising ease.

       What is a regular expression?  At its most basic, a regular expression
       is a template that is used to determine if a string has certain
       characteristics.	 The string is most often some text, such as a line,
       sentence, web page, or even a whole book, but less commonly it could be
       some binary data	as well.  Suppose we want to determine if the text in
       variable, $var contains the sequence of characters "m u s h r o o m"
       (blanks added for legibility).  We can write in Perl

	$var =~	m/mushroom/

       The value of this expression will be TRUE if $var contains that
       sequence	of characters, and FALSE otherwise.  The portion enclosed in
       '/' characters denotes the characteristic we are	looking	for.  We use
       the term	pattern	for it.	 The process of	looking	to see if the pattern
       occurs in the string is called matching,	and the	"=~" operator along
       with the	"m//" tell Perl	to try to match	the pattern against the
       string.	Note that the pattern is also a	string,	but a very special
       kind of one, as we will see.  Patterns are in common use	these days;
       examples	are the	patterns typed into a search engine to find web	pages
       and the patterns	used to	list files in a	directory, e.g., ""ls *.txt""
       or ""dir	*.*"".	In Perl, the patterns described	by regular expressions
       are used	not only to search strings, but	to also	extract	desired	parts
       of strings, and to do search and	replace	operations.

       Regular expressions have	the undeserved reputation of being abstract
       and difficult to	understand.  This really stems simply because the
       notation	used to	express	them tends to be terse and dense, and not
       because of inherent complexity.	We recommend using the "/x" regular
       expression modifier (described below) along with	plenty of white	space
       to make them less dense,	and easier to read.  Regular expressions are
       constructed using simple	concepts like conditionals and loops and are
       no more difficult to understand than the	corresponding "if"
       conditionals and	"while"	loops in the Perl language itself.

       This tutorial flattens the learning curve by discussing regular
       expression concepts, along with their notation, one at a	time and with
       many examples.  The first part of the tutorial will progress from the
       simplest	word searches to the basic regular expression concepts.	 If
       you master the first part, you will have	all the	tools needed to	solve
       about 98% of your needs.	 The second part of the	tutorial is for	those
       comfortable with	the basics and hungry for more power tools.  It
       discusses the more advanced regular expression operators	and introduces
       the latest cutting-edge innovations.

       A note: to save time, "regular expression" is often abbreviated as
       regexp or regex.	 Regexp	is a more natural abbreviation than regex, but
       is harder to pronounce.	The Perl pod documentation is evenly split on
       regexp vs regex;	in Perl, there is more than one	way to abbreviate it.
       We'll use regexp	in this	tutorial.

       New in v5.22, "use re 'strict'" applies stricter	rules than otherwise
       when compiling regular expression patterns.  It can find	things that,
       while legal, may	not be what you	intended.

Part 1:	The basics
   Simple word matching
       The simplest regexp is simply a word, or	more generally,	a string of
       characters.  A regexp consisting	of just	a word matches any string that
       contains	that word:

	   "Hello World" =~ /World/;  #	matches

       What is this Perl statement all about? "Hello World" is a simple
       double-quoted string.  "World" is the regular expression	and the	"//"
       enclosing "/World/" tells Perl to search	a string for a match.  The
       operator	"=~" associates	the string with	the regexp match and produces
       a true value if the regexp matched, or false if the regexp did not
       match.  In our case, "World" matches the	second word in "Hello World",
       so the expression is true.  Expressions like this are useful in
       conditionals:

	   if ("Hello World" =~	/World/) {
	       print "It matches\n";
	   }
	   else	{
	       print "It doesn't match\n";
	   }

       There are useful	variations on this theme.  The sense of	the match can
       be reversed by using the	"!~" operator:

	   if ("Hello World" !~	/World/) {
	       print "It doesn't match\n";
	   }
	   else	{
	       print "It matches\n";
	   }

       The literal string in the regexp	can be replaced	by a variable:

	   my $greeting	= "World";
	   if ("Hello World" =~	/$greeting/) {
	       print "It matches\n";
	   }
	   else	{
	       print "It doesn't match\n";
	   }

       If you're matching against the special default variable $_, the "$_ =~"
       part can	be omitted:

	   $_ =	"Hello World";
	   if (/World/)	{
	       print "It matches\n";
	   }
	   else	{
	       print "It doesn't match\n";
	   }

       And finally, the	"//" default delimiters	for a match can	be changed to
       arbitrary delimiters by putting an 'm' out front:

	   "Hello World" =~ m!World!;	# matches, delimited by	'!'
	   "Hello World" =~ m{World};	# matches, note	the matching '{}'
	   "/usr/bin/perl" =~ m"/perl";	# matches after	'/usr/bin',
					# '/' becomes an ordinary char

       "/World/", "m!World!", and "m{World}" all represent the same thing.
       When, e.g., the quote ('"') is used as a	delimiter, the forward slash
       '/' becomes an ordinary character and can be used in this regexp
       without trouble.

       Let's consider how different regexps would match	"Hello World":

	   "Hello World" =~ /world/;  #	doesn't	match
	   "Hello World" =~ /o W/;    #	matches
	   "Hello World" =~ /oW/;     #	doesn't	match
	   "Hello World" =~ /World /; #	doesn't	match

       The first regexp	"world"	doesn't	match because regexps are case-
       sensitive.  The second regexp matches because the substring 'o W'
       occurs in the string "Hello World".  The	space character	' ' is treated
       like any	other character	in a regexp and	is needed to match in this
       case.  The lack of a space character is the reason the third regexp
       'oW' doesn't match.  The	fourth regexp ""World "" doesn't match because
       there is	a space	at the end of the regexp, but not at the end of	the
       string.	The lesson here	is that	regexps	must match a part of the
       string exactly in order for the statement to be true.

       If a regexp matches in more than	one place in the string, Perl will
       always match at the earliest possible point in the string:

	   "Hello World" =~ /o/;       # matches 'o' in	'Hello'
	   "That hat is	red" =~	/hat/; # matches 'hat' in 'That'

       With respect to character matching, there are a few more	points you
       need to know about.   First of all, not all characters can be used "as
       is" in a	match.	Some characters, called	metacharacters,	are reserved
       for use in regexp notation.  The	metacharacters are

	   {}[]()^$.|*+?-\

       The significance	of each	of these will be explained in the rest of the
       tutorial, but for now, it is important only to know that	a
       metacharacter can be matched as-is by putting a backslash before	it:

	   "2+2=4" =~ /2+2/;	# doesn't match, + is a	metacharacter
	   "2+2=4" =~ /2\+2/;	# matches, \+ is treated like an ordinary +
	   "The	interval is [0,1)." =~ /[0,1)./	    # is a syntax error!
	   "The	interval is [0,1)." =~ /\[0,1\)\./  # matches
	   "#!/usr/bin/perl" =~	/#!\/usr\/bin\/perl/;  # matches

       In the last regexp, the forward slash '/' is also backslashed, because
       it is used to delimit the regexp.  This can lead	to LTS (leaning
       toothpick syndrome), however, and it is often more readable to change
       delimiters.

	   "#!/usr/bin/perl" =~	m!#\!/usr/bin/perl!;  #	easier to read

       The backslash character '\' is a	metacharacter itself and needs to be
       backslashed:

	   'C:\WIN32' =~ /C:\\WIN/;   #	matches

       In situations where it doesn't make sense for a particular
       metacharacter to	mean what it normally does, it automatically loses its
       metacharacter-ness and becomes an ordinary character that is to be
       matched literally.  For example,	the '}'	is a metacharacter only	when
       it is the mate of a '{' metacharacter.  Otherwise it is treated as a
       literal RIGHT CURLY BRACKET.  This may lead to unexpected results.
       "use re 'strict'" can catch some	of these.

       In addition to the metacharacters, there	are some ASCII characters
       which don't have	printable character equivalents	and are	instead
       represented by escape sequences.	 Common	examples are "\t" for a	tab,
       "\n" for	a newline, "\r"	for a carriage return and "\a" for a bell (or
       alert).	If your	string is better thought of as a sequence of arbitrary
       bytes, the octal	escape sequence, e.g., "\033", or hexadecimal escape
       sequence, e.g., "\x1B" may be a more natural representation for your
       bytes.  Here are	some examples of escapes:

	   "1000\t2000"	=~ m(0\t2)   # matches
	   "1000\n2000"	=~ /0\n20/   # matches
	   "1000\t2000"	=~ /\000\t2/ # doesn't match, "0" ne "\000"
	   "cat"   =~ /\o{143}\x61\x74/	# matches in ASCII, but	a weird	way
					# to spell cat

       If you've been around Perl a while, all this talk of escape sequences
       may seem	familiar.  Similar escape sequences are	used in	double-quoted
       strings and in fact the regexps in Perl are mostly treated as double-
       quoted strings.	This means that	variables can be used in regexps as
       well.  Just like	double-quoted strings, the values of the variables in
       the regexp will be substituted in before	the regexp is evaluated	for
       matching	purposes.  So we have:

	   $foo	= 'house';
	   'housecat' =~ /$foo/;      #	matches
	   'cathouse' =~ /cat$foo/;   #	matches
	   'housecat' =~ /${foo}cat/; #	matches

       So far, so good.	 With the knowledge above you can already perform
       searches	with just about	any literal string regexp you can dream	up.
       Here is a very simple emulation of the Unix grep	program:

	   % cat > simple_grep
	   #!/usr/bin/perl
	   $regexp = shift;
	   while (<>) {
	       print if	/$regexp/;
	   }
	   ^D

	   % chmod +x simple_grep

	   % simple_grep abba /usr/dict/words
	   Babbage
	   cabbage
	   cabbages
	   sabbath
	   Sabbathize
	   Sabbathizes
	   sabbatical
	   scabbard
	   scabbards

       This program is easy to understand.  "#!/usr/bin/perl" is the standard
       way to invoke a perl program from the shell.  "$regexp =	shift;"	saves
       the first command line argument as the regexp to	be used, leaving the
       rest of the command line	arguments to be	treated	as files.
       "while (<>)" loops over all the lines in	all the	files.	For each line,
       "print if /$regexp/;" prints the	line if	the regexp matches the line.
       In this line, both "print" and "/$regexp/" use the default variable $_
       implicitly.

       With all	of the regexps above, if the regexp matched anywhere in	the
       string, it was considered a match.  Sometimes, however, we'd like to
       specify where in	the string the regexp should try to match.  To do
       this, we	would use the anchor metacharacters '^'	and '$'.  The anchor
       '^' means match at the beginning	of the string and the anchor '$' means
       match at	the end	of the string, or before a newline at the end of the
       string.	Here is	how they are used:

	   "housekeeper" =~ /keeper/;	 # matches
	   "housekeeper" =~ /^keeper/;	 # doesn't match
	   "housekeeper" =~ /keeper$/;	 # matches
	   "housekeeper\n" =~ /keeper$/; # matches

       The second regexp doesn't match because '^' constrains "keeper" to
       match only at the beginning of the string, but "housekeeper" has	keeper
       starting	in the middle.	The third regexp does match, since the '$'
       constrains "keeper" to match only at the	end of the string.

       When both '^' and '$' are used at the same time,	the regexp has to
       match both the beginning	and the	end of the string, i.e., the regexp
       matches the whole string.  Consider

	   "keeper" =~ /^keep$/;      #	doesn't	match
	   "keeper" =~ /^keeper$/;    #	matches
	   ""	    =~ /^$/;	      #	^$ matches an empty string

       The first regexp	doesn't	match because the string has more to it	than
       "keep".	Since the second regexp	is exactly the string, it matches.
       Using both '^' and '$' in a regexp forces the complete string to	match,
       so it gives you complete	control	over which strings match and which
       don't.  Suppose you are looking for a fellow named bert,	off in a
       string by himself:

	   "dogbert" =~	/bert/;	  # matches, but not what you want

	   "dilbert" =~	/^bert/;  # doesn't match, but ..
	   "bertram" =~	/^bert/;  # matches, so	still not good enough

	   "bertram" =~	/^bert$/; # doesn't match, good
	   "dilbert" =~	/^bert$/; # doesn't match, good
	   "bert"    =~	/^bert$/; # matches, perfect

       Of course, in the case of a literal string, one could just as easily
       use the string comparison "$string eq 'bert'" and it would be more
       efficient.   The	 "^...$" regexp	really becomes useful when we add in
       the more	powerful regexp	tools below.

   Using character classes
       Although	one can	already	do quite a lot with the	literal	string regexps
       above, we've only scratched the surface of regular expression
       technology.  In this and	subsequent sections we will introduce regexp
       concepts	(and associated	metacharacter notations) that will allow a
       regexp to represent not just a single character sequence, but a whole
       class of	them.

       One such	concept	is that	of a character class.  A character class
       allows a	set of possible	characters, rather than	just a single
       character, to match at a	particular point in a regexp.  You can define
       your own	custom character classes.  These are denoted by	brackets
       "[...]",	with the set of	characters to be possibly matched inside.
       Here are	some examples:

	   /cat/;	# matches 'cat'
	   /[bcr]at/;	# matches 'bat,	'cat', or 'rat'
	   /item[0123456789]/;	# matches 'item0' or ... or 'item9'
	   "abc" =~ /[cab]/;	# matches 'a'

       In the last statement, even though 'c' is the first character in	the
       class, 'a' matches because the first character position in the string
       is the earliest point at	which the regexp can match.

	   /[yY][eE][sS]/;	# match	'yes' in a case-insensitive way
				# 'yes', 'Yes',	'YES', etc.

       This regexp displays a common task: perform a case-insensitive match.
       Perl provides a way of avoiding all those brackets by simply appending
       an 'i' to the end of the	match.	Then "/[yY][eE][sS]/;" can be
       rewritten as "/yes/i;".	The 'i'	stands for case-insensitive and	is an
       example of a modifier of	the matching operation.	 We will meet other
       modifiers later in the tutorial.

       We saw in the section above that	there were ordinary characters,	which
       represented themselves, and special characters, which needed a
       backslash '\' to	represent themselves.  The same	is true	in a character
       class, but the sets of ordinary and special characters inside a
       character class are different than those	outside	a character class.
       The special characters for a character class are	"-]\^$"	(and the
       pattern delimiter, whatever it is).  ']'	is special because it denotes
       the end of a character class.  '$' is special because it	denotes	a
       scalar variable.	 '\' is	special	because	it is used in escape
       sequences, just like above.  Here is how	the special characters "]$\"
       are handled:

	  /[\]c]def/; #	matches	']def' or 'cdef'
	  $x = 'bcr';
	  /[$x]at/;   #	matches	'bat', 'cat', or 'rat'
	  /[\$x]at/;  #	matches	'$at' or 'xat'
	  /[\\$x]at/; #	matches	'\at', 'bat, 'cat', or 'rat'

       The last	two are	a little tricky.  In "[\$x]", the backslash protects
       the dollar sign,	so the character class has two members '$' and 'x'.
       In "[\\$x]", the	backslash is protected,	so $x is treated as a variable
       and substituted in double quote fashion.

       The special character '-' acts as a range operator within character
       classes,	so that	a contiguous set of characters can be written as a
       range.  With ranges, the	unwieldy "[0123456789]"	and "[abc...xyz]"
       become the svelte "[0-9]" and "[a-z]".  Some examples are

	   /item[0-9]/;	 # matches 'item0' or ... or 'item9'
	   /[0-9bx-z]aa/;  # matches '0aa', ..., '9aa',
			   # 'baa', 'xaa', 'yaa', or 'zaa'
	   /[0-9a-fA-F]/;  # matches a hexadecimal digit
	   /[0-9a-zA-Z_]/; # matches a "word" character,
			   # like those	in a Perl variable name

       If '-' is the first or last character in	a character class, it is
       treated as an ordinary character; "[-ab]", "[ab-]" and "[a\-b]" are all
       equivalent.

       The special character '^' in the	first position of a character class
       denotes a negated character class, which	matches	any character but
       those in	the brackets.  Both "[...]" and	"[^...]" must match a
       character, or the match fails.  Then

	   /[^a]at/;  #	doesn't	match 'aat' or 'at', but matches
		      #	all other 'bat', 'cat, '0at', '%at', etc.
	   /[^0-9]/;  #	matches	a non-numeric character
	   /[a^]at/;  #	matches	'aat' or '^at';	here '^' is ordinary

       Now, even "[0-9]" can be	a bother to write multiple times, so in	the
       interest	of saving keystrokes and making	regexps	more readable, Perl
       has several abbreviations for common character classes, as shown	below.
       Since the introduction of Unicode, unless the "/a" modifier is in
       effect, these character classes match more than just a few characters
       in the ASCII range.

       o   "\d"	matches	a digit, not just "[0-9]" but also digits from non-
	   roman scripts

       o   "\s"	matches	a whitespace character,	the set	"[\ \t\r\n\f]" and
	   others

       o   "\w"	matches	a word character (alphanumeric or '_'),	not just
	   "[0-9a-zA-Z_]" but also digits and characters from non-roman
	   scripts

       o   "\D"	is a negated "\d"; it represents any other character than a
	   digit, or "[^\d]"

       o   "\S"	is a negated "\s"; it represents any non-whitespace character
	   "[^\s]"

       o   "\W"	is a negated "\w"; it represents any non-word character
	   "[^\w]"

       o   The period '.' matches any character	but "\n" (unless the modifier
	   "/s"	is in effect, as explained below).

       o   "\N", like the period, matches any character	but "\n", but it does
	   so regardless of whether the	modifier "/s" is in effect.

       The "/a"	modifier, available starting in	Perl 5.14,  is used to
       restrict	the matches of "\d", "\s", and "\w" to just those in the ASCII
       range.  It is useful to keep your program from being needlessly exposed
       to full Unicode (and its	accompanying security considerations) when all
       you want	is to process English-like text.  (The "a" may be doubled,
       "/aa", to provide even more restrictions, preventing case-insensitive
       matching	of ASCII with non-ASCII	characters; otherwise a	Unicode
       "Kelvin Sign" would caselessly match a "k" or "K".)

       The "\d\s\w\D\S\W" abbreviations	can be used both inside	and outside of
       bracketed character classes.  Here are some in use:

	   /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
	   /[\d\s]/;	     # matches any digit or whitespace character
	   /\w\W\w/;	     # matches a word char, followed by	a
			     # non-word	char, followed by a word char
	   /..rt/;	     # matches any two chars, followed by 'rt'
	   /end\./;	     # matches 'end.'
	   /end[.]/;	     # same thing, matches 'end.'

       Because a period	is a metacharacter, it needs to	be escaped to match as
       an ordinary period. Because, for	example, "\d" and "\w" are sets	of
       characters, it is incorrect to think of "[^\d\w]" as "[\D\W]"; in fact
       "[^\d\w]" is the	same as	"[^\w]", which is the same as "[\W]". Think
       DeMorgan's laws.

       In actuality, the period	and "\d\s\w\D\S\W" abbreviations are
       themselves types	of character classes, so the ones surrounded by
       brackets	are just one type of character class.  When we need to make a
       distinction, we refer to	them as	"bracketed character classes."

       An anchor useful	in basic regexps is the	word anchor "\b".  This
       matches a boundary between a word character and a non-word character
       "\w\W" or "\W\w":

	   $x =	"Housecat catenates house and cat";
	   $x =~ /cat/;	   # matches cat in 'housecat'
	   $x =~ /\bcat/;  # matches cat in 'catenates'
	   $x =~ /cat\b/;  # matches cat in 'housecat'
	   $x =~ /\bcat\b/;  # matches 'cat' at	end of string

       Note in the last	example, the end of the	string is considered a word
       boundary.

       For natural language processing (so that, for example, apostrophes are
       included	in words), use instead "\b{wb}"

	   "don't" =~ /	.+? \b{wb} /x;	# matches the whole string

       You might wonder	why '.'	matches	everything but "\n" - why not every
       character? The reason is	that often one is matching against lines and
       would like to ignore the	newline	characters.  For instance, while the
       string "\n" represents one line,	we would like to think of it as	empty.
       Then

	   ""	=~ /^$/;    # matches
	   "\n"	=~ /^$/;    # matches, $ anchors before	"\n"

	   ""	=~ /./;	     # doesn't match; it needs a char
	   ""	=~ /^.$/;    # doesn't match; it needs a char
	   "\n"	=~ /^.$/;    # doesn't match; it needs a char other than "\n"
	   "a"	=~ /^.$/;    # matches
	   "a\n"  =~ /^.$/;  # matches,	$ anchors before "\n"

       This behavior is	convenient, because we usually want to ignore newlines
       when we count and match characters in a line.  Sometimes, however, we
       want to keep track of newlines.	We might even want '^' and '$' to
       anchor at the beginning and end of lines	within the string, rather than
       just the	beginning and end of the string.  Perl allows us to choose
       between ignoring	and paying attention to	newlines by using the "/s" and
       "/m" modifiers.	"/s" and "/m" stand for	single line and	multi-line and
       they determine whether a	string is to be	treated	as one continuous
       string, or as a set of lines.  The two modifiers	affect two aspects of
       how the regexp is interpreted: 1) how the '.' character class is
       defined,	and 2) where the anchors '^' and '$' are able to match.	 Here
       are the four possible combinations:

       o   no modifiers: Default behavior.  '.'	matches	any character except
	   "\n".  '^' matches only at the beginning of the string and '$'
	   matches only	at the end or before a newline at the end.

       o   s modifier ("/s"): Treat string as a	single long line.  '.' matches
	   any character, even "\n".  '^' matches only at the beginning	of the
	   string and '$' matches only at the end or before a newline at the
	   end.

       o   m modifier ("/m"): Treat string as a	set of multiple	lines.	'.'
	   matches any character except	"\n".  '^' and '$' are able to match
	   at the start	or end of any line within the string.

       o   both	s and m	modifiers ("/sm"): Treat string	as a single long line,
	   but detect multiple lines.  '.' matches any character, even "\n".
	   '^' and '$',	however, are able to match at the start	or end of any
	   line	within the string.

       Here are	examples of "/s" and "/m" in action:

	   $x =	"There once was	a girl\nWho programmed in Perl\n";

	   $x =~ /^Who/;   # doesn't match, "Who" not at start of string
	   $x =~ /^Who/s;  # doesn't match, "Who" not at start of string
	   $x =~ /^Who/m;  # matches, "Who" at start of	second line
	   $x =~ /^Who/sm; # matches, "Who" at start of	second line

	   $x =~ /girl.Who/;   # doesn't match,	"." doesn't match "\n"
	   $x =~ /girl.Who/s;  # matches, "." matches "\n"
	   $x =~ /girl.Who/m;  # doesn't match,	"." doesn't match "\n"
	   $x =~ /girl.Who/sm; # matches, "." matches "\n"

       Most of the time, the default behavior is what is wanted, but "/s" and
       "/m" are	occasionally very useful.  If "/m" is being used, the start of
       the string can still be matched with "\A" and the end of	the string can
       still be	matched	with the anchors "\Z" (matches both the	end and	the
       newline before, like '$'), and "\z" (matches only the end):

	   $x =~ /^Who/m;   # matches, "Who" at	start of second	line
	   $x =~ /\AWho/m;  # doesn't match, "Who" is not at start of string

	   $x =~ /girl$/m;  # matches, "girl" at end of	first line
	   $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string

	   $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
	   $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string

       We now know how to create choices among classes of characters in	a
       regexp.	What about choices among words or character strings? Such
       choices are described in	the next section.

   Matching this or that
       Sometimes we would like our regexp to be	able to	match different
       possible	words or character strings.  This is accomplished by using the
       alternation metacharacter '|'.  To match	"dog" or "cat",	we form	the
       regexp "dog|cat".  As before, Perl will try to match the	regexp at the
       earliest	possible point in the string.  At each character position,
       Perl will first try to match the	first alternative, "dog".  If "dog"
       doesn't match, Perl will	then try the next alternative, "cat".  If
       "cat" doesn't match either, then	the match fails	and Perl moves to the
       next position in	the string.  Some examples:

	   "cats and dogs" =~ /cat|dog|bird/;  # matches "cat"
	   "cats and dogs" =~ /dog|cat|bird/;  # matches "cat"

       Even though "dog" is the	first alternative in the second	regexp,	"cat"
       is able to match	earlier	in the string.

	   "cats"	   =~ /c|ca|cat|cats/; # matches "c"
	   "cats"	   =~ /cats|cat|ca|c/; # matches "cats"

       Here, all the alternatives match	at the first string position, so the
       first alternative is the	one that matches.  If some of the alternatives
       are truncations of the others, put the longest ones first to give them
       a chance	to match.

	   "cab" =~ /a|b|c/ # matches "c"
			    # /a|b|c/ == /[abc]/

       The last	example	points out that	character classes are like
       alternations of characters.  At a given character position, the first
       alternative that	allows the regexp match	to succeed will	be the one
       that matches.

   Grouping things and hierarchical matching
       Alternation allows a regexp to choose among alternatives, but by	itself
       it is unsatisfying.  The	reason is that each alternative	is a whole
       regexp, but sometime we want alternatives for just part of a regexp.
       For instance, suppose we	want to	search for housecats or	housekeepers.
       The regexp "housecat|housekeeper" fits the bill,	but is inefficient
       because we had to type "house" twice.  It would be nice to have parts
       of the regexp be	constant, like "house",	and some parts have
       alternatives, like "cat|keeper".

       The grouping metacharacters "()"	solve this problem.  Grouping allows
       parts of	a regexp to be treated as a single unit.  Parts	of a regexp
       are grouped by enclosing	them in	parentheses.  Thus we could solve the
       "housecat|housekeeper" by forming the regexp as "house(cat|keeper)".
       The regexp "house(cat|keeper)" means match "house" followed by either
       "cat" or	"keeper".  Some	more examples are

	   /(a|b)b/;	# matches 'ab' or 'bb'
	   /(ac|b)b/;	# matches 'acb'	or 'bb'
	   /(^a|b)c/;	# matches 'ac' at start	of string or 'bc' anywhere
	   /(a|[bc])d/;	# matches 'ad',	'bd', or 'cd'

	   /house(cat|)/;  # matches either 'housecat' or 'house'
	   /house(cat(s|)|)/;  # matches either	'housecats' or 'housecat' or
			       # 'house'.  Note	groups can be nested.

	   /(19|20|)\d\d/;  # match years 19xx,	20xx, or the Y2K problem, xx
	   "20"	=~ /(19|20|)\d\d/;  # matches the null alternative '()\d\d',
				    # because '20\d\d' can't match

       Alternations behave the same way	in groups as out of them: at a given
       string position,	the leftmost alternative that allows the regexp	to
       match is	taken.	So in the last example at the first string position,
       "20" matches the	second alternative, but	there is nothing left over to
       match the next two digits "\d\d".  So Perl moves	on to the next
       alternative, which is the null alternative and that works, since	"20"
       is two digits.

       The process of trying one alternative, seeing if	it matches, and	moving
       on to the next alternative, while going back in the string from where
       the previous alternative	was tried, if it doesn't, is called
       backtracking.  The term "backtracking" comes from the idea that
       matching	a regexp is like a walk	in the woods.  Successfully matching a
       regexp is like arriving at a destination.  There	are many possible
       trailheads, one for each	string position, and each one is tried in
       order, left to right.  From each	trailhead there	may be many paths,
       some of which get you there, and	some which are dead ends.  When	you
       walk along a trail and hit a dead end, you have to backtrack along the
       trail to	an earlier point to try	another	trail.	If you hit your
       destination, you	stop immediately and forget about trying all the other
       trails.	You are	persistent, and	only if	you have tried all the trails
       from all	the trailheads and not arrived at your destination, do you
       declare failure.	 To be concrete, here is a step-by-step	analysis of
       what Perl does when it tries to match the regexp

	   "abcde" =~ /(abd|abc)(df|d|de)/;

       0. Start	with the first letter in the string 'a'.

       1. Try the first	alternative in the first group 'abd'.

       2.  Match 'a' followed by 'b'. So far so	good.

       3.  'd' in the regexp doesn't match 'c' in the string - a dead end.  So
       backtrack two characters	and pick the second alternative	in the first
       group 'abc'.

       4.  Match 'a' followed by 'b' followed by 'c'.  We are on a roll	and
       have satisfied the first	group. Set $1 to 'abc'.

       5 Move on to the	second group and pick the first	alternative 'df'.

       6 Match the 'd'.

       7.  'f' in the regexp doesn't match 'e' in the string, so a dead	end.
       Backtrack one character and pick	the second alternative in the second
       group 'd'.

       8.  'd' matches.	The second grouping is satisfied, so set $2 to 'd'.

       9.  We are at the end of	the regexp, so we are done! We have matched
       'abcd' out of the string	"abcde".

       There are a couple of things to note about this analysis.  First, the
       third alternative in the	second group 'de' also allows a	match, but we
       stopped before we got to	it - at	a given	character position, leftmost
       wins.  Second, we were able to get a match at the first character
       position	of the string 'a'.  If there were no matches at	the first
       position, Perl would move to the	second character position 'b' and
       attempt the match all over again.  Only when all	possible paths at all
       possible	character positions have been exhausted	does Perl give up and
       declare "$string	=~ /(abd|abc)(df|d|de)/;" to be	false.

       Even with all this work,	regexp matching	happens	remarkably fast.  To
       speed things up,	Perl compiles the regexp into a	compact	sequence of
       opcodes that can	often fit inside a processor cache.  When the code is
       executed, these opcodes can then	run at full throttle and search	very
       quickly.

   Extracting matches
       The grouping metacharacters "()"	also serve another completely
       different function: they	allow the extraction of	the parts of a string
       that matched.  This is very useful to find out what matched and for
       text processing in general.  For	each grouping, the part	that matched
       inside goes into	the special variables $1, $2, etc.  They can be	used
       just as ordinary	variables:

	   # extract hours, minutes, seconds
	   if ($time =~	/(\d\d):(\d\d):(\d\d)/)	{    # match hh:mm:ss format
	       $hours =	$1;
	       $minutes	= $2;
	       $seconds	= $3;
	   }

       Now, we know that in scalar context, "$time =~ /(\d\d):(\d\d):(\d\d)/"
       returns a true or false value.  In list context,	however, it returns
       the list	of matched values "($1,$2,$3)".	 So we could write the code
       more compactly as

	   # extract hours, minutes, seconds
	   ($hours, $minutes, $second) = ($time	=~ /(\d\d):(\d\d):(\d\d)/);

       If the groupings	in a regexp are	nested,	$1 gets	the group with the
       leftmost	opening	parenthesis, $2	the next opening parenthesis, etc.
       Here is a regexp	with nested groups:

	   /(ab(cd|ef)((gi)|j))/;
	    1  2      34

       If this regexp matches, $1 contains a string starting with 'ab',	$2 is
       either set to 'cd' or 'ef', $3 equals either 'gi' or 'j', and $4	is
       either set to 'gi', just	like $3, or it remains undefined.

       For convenience,	Perl sets $+ to	the string held	by the highest
       numbered	$1, $2,... that	got assigned (and, somewhat related, $^N to
       the value of the	$1, $2,... most-recently assigned; i.e.	the $1,	$2,...
       associated with the rightmost closing parenthesis used in the match).

   Backreferences
       Closely associated with the matching variables $1, $2, ... are the
       backreferences "\g1", "\g2",...	Backreferences are simply matching
       variables that can be used inside a regexp.  This is a really nice
       feature;	what matches later in a	regexp is made to depend on what
       matched earlier in the regexp.  Suppose we wanted to look for doubled
       words in	a text,	like "the the".	 The following regexp finds all
       3-letter	doubles	with a space in	between:

	   /\b(\w\w\w)\s\g1\b/;

       The grouping assigns a value to "\g1", so that the same 3-letter
       sequence	is used	for both parts.

       A similar task is to find words consisting of two identical parts:

	   % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
	   beriberi
	   booboo
	   coco
	   mama
	   murmur
	   papa

       The regexp has a	single grouping	which considers	4-letter combinations,
       then 3-letter combinations, etc., and uses "\g1"	to look	for a repeat.
       Although	$1 and "\g1" represent the same	thing, care should be taken to
       use matched variables $1, $2,...	only outside a regexp and
       backreferences "\g1", "\g2",... only inside a regexp; not doing so may
       lead to surprising and unsatisfactory results.

   Relative backreferences
       Counting	the opening parentheses	to get the correct number for a
       backreference is	error-prone as soon as there is	more than one
       capturing group.	 A more	convenient technique became available with
       Perl 5.10: relative backreferences. To refer to the immediately
       preceding capture group one now may write "\g{-1}", the next but	last
       is available via	"\g{-2}", and so on.

       Another good reason in addition to readability and maintainability for
       using relative backreferences is	illustrated by the following example,
       where a simple pattern for matching peculiar strings is used:

	   $a99a = '([a-z])(\d)\g2\g1';	  # matches a11a, g22g,	x33x, etc.

       Now that	we have	this pattern stored as a handy string, we might	feel
       tempted to use it as a part of some other pattern:

	   $line = "code=e99e";
	   if ($line =~	/^(\w+)=$a99a$/){   # unexpected behavior!
	       print "$1 is valid\n";
	   } else {
	       print "bad line:	'$line'\n";
	   }

       But this	doesn't	match, at least	not the	way one	might expect. Only
       after inserting the interpolated	$a99a and looking at the resulting
       full text of the	regexp is it obvious that the backreferences have
       backfired. The subexpression "(\w+)" has	snatched number	1 and demoted
       the groups in $a99a by one rank.	This can be avoided by using relative
       backreferences:

	   $a99a = '([a-z])(\d)\g{-1}\g{-2}';  # safe for being	interpolated

   Named backreferences
       Perl 5.10 also introduced named capture groups and named
       backreferences.	To attach a name to a capturing	group, you write
       either "(?<name>...)" or	"(?'name'...)".	 The backreference may then be
       written as "\g{name}".  It is permissible to attach the same name to
       more than one group, but	then only the leftmost one of the eponymous
       set can be referenced.  Outside of the pattern a	named capture group is
       accessible through the "%+" hash.

       Assuming	that we	have to	match calendar dates which may be given	in one
       of the three formats yyyy-mm-dd,	mm/dd/yyyy or dd.mm.yyyy, we can write
       three suitable patterns where we	use 'd', 'm' and 'y' respectively as
       the names of the	groups capturing the pertaining	components of a	date.
       The matching operation combines the three patterns as alternatives:

	   $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
	   $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
	   $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
	   for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){
	       if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
		   print "day=$+{d} month=$+{m}	year=$+{y}\n";
	       }
	   }

       If any of the alternatives matches, the hash "%+" is bound to contain
       the three key-value pairs.

   Alternative capture group numbering
       Yet another capturing group numbering technique (also as	from Perl
       5.10) deals with	the problem of referring to groups within a set	of
       alternatives.  Consider a pattern for matching a	time of	the day, civil
       or military style:

	   if (	$time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
	       # process hour and minute
	   }

       Processing the results requires an additional if	statement to determine
       whether $1 and $2 or $3 and $4 contain the goodies. It would be easier
       if we could use group numbers 1 and 2 in	second alternative as well,
       and this	is exactly what	the parenthesized construct "(?|...)", set
       around an alternative achieves. Here is an extended version of the
       previous	pattern:

	 if($time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/){
	     print "hour=$1 minute=$2 zone=$3\n";
	 }

       Within the alternative numbering	group, group numbers start at the same
       position	for each alternative. After the	group, numbering continues
       with one	higher than the	maximum	reached	across all the alternatives.

   Position information
       In addition to what was matched,	Perl also provides the positions of
       what was	matched	as contents of the "@-"	and "@+" arrays. "$-[0]" is
       the position of the start of the	entire match and $+[0] is the position
       of the end. Similarly, "$-[n]" is the position of the start of the $n
       match and $+[n] is the position of the end. If $n is undefined, so are
       "$-[n]" and $+[n]. Then this code

	   $x =	"Mmm...donut, thought Homer";
	   $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
	   foreach $exp	(1..$#-) {
	       print "Match $exp: '${$exp}' at position	($-[$exp],$+[$exp])\n";
	   }

       prints

	   Match 1: 'Mmm' at position (0,3)
	   Match 2: 'donut' at position	(6,11)

       Even if there are no groupings in a regexp, it is still possible	to
       find out	what exactly matched in	a string.  If you use them, Perl will
       set "$`"	to the part of the string before the match, will set $&	to the
       part of the string that matched,	and will set '$' to the	part of	the
       string after the	match.	An example:

	   $x =	"the cat caught	the mouse";
	   $x =~ /cat/;	 # $` =	'the ',	$& = 'cat', $' = ' caught the mouse'
	   $x =~ /the/;	 # $` =	'', $& = 'the',	$' = ' cat caught the mouse'

       In the second match, "$`" equals	'' because the regexp matched at the
       first character position	in the string and stopped; it never saw	the
       second "the".

       If your code is to run on Perl versions earlier than 5.20, it is
       worthwhile to note that using "$`" and '$' slows	down regexp matching
       quite a bit, while $& slows it down to a	lesser extent, because if they
       are used	in one regexp in a program, they are generated for all regexps
       in the program.	So if raw performance is a goal	of your	application,
       they should be avoided.	If you need to extract the corresponding
       substrings, use "@-" and	"@+" instead:

	   $` is the same as substr( $x, 0, $-[0] )
	   $& is the same as substr( $x, $-[0],	$+[0]-$-[0] )
	   $' is the same as substr( $x, $+[0] )

       As of Perl 5.10,	the "${^PREMATCH}", "${^MATCH}"	and "${^POSTMATCH}"
       variables may be	used.  These are only set if the "/p" modifier is
       present.	 Consequently they do not penalize the rest of the program.
       In Perl 5.20, "${^PREMATCH}", "${^MATCH}" and "${^POSTMATCH}" are
       available whether the "/p" has been used	or not (the modifier is
       ignored), and "$`", '$' and $& do not cause any speed difference.

   Non-capturing groupings
       A group that is required	to bundle a set	of alternatives	may or may not
       be useful as a capturing	group.	If it isn't, it	just creates a
       superfluous addition to the set of available capture group values,
       inside as well as outside the regexp.  Non-capturing groupings, denoted
       by "(?:regexp)",	still allow the	regexp to be treated as	a single unit,
       but don't establish a capturing group at	the same time.	Both capturing
       and non-capturing groupings are allowed to co-exist in the same regexp.
       Because there is	no extraction, non-capturing groupings are faster than
       capturing groupings.  Non-capturing groupings are also handy for
       choosing	exactly	which parts of a regexp	are to be extracted to
       matching	variables:

	   # match a number, $1-$4 are set, but	we only	want $1
	   /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;

	   # match a number faster , only $1 is	set
	   /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;

	   # match a number, get $1 = whole number, $2 = exponent
	   /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;

       Non-capturing groupings are also	useful for removing nuisance elements
       gathered	from a split operation where parentheses are required for some
       reason:

	   $x =	'12aba34ba5';
	   @num	= split	/(a|b)+/, $x;	 # @num	= ('12','a','34','a','5')
	   @num	= split	/(?:a|b)+/, $x;	 # @num	= ('12','34','5')

       In Perl 5.22 and	later, all groups within a regexp can be set to	non-
       capturing by using the new "/n" flag:

	   "hello" =~ /(hi|hello)/n; # $1 is not set!

       See "n" in perlre for more information.

   Matching repetitions
       The examples in the previous section display an annoying	weakness.  We
       were only matching 3-letter words, or chunks of words of	4 letters or
       less.  We'd like	to be able to match words or, more generally, strings
       of any length, without writing out tedious alternatives like
       "\w\w\w\w|\w\w\w|\w\w|\w".

       This is exactly the problem the quantifier metacharacters '?', '*',
       '+', and	"{}" were created for.	They allow us to delimit the number of
       repeats for a portion of	a regexp we consider to	be a match.
       Quantifiers are put immediately after the character, character class,
       or grouping that	we want	to specify.  They have the following meanings:

       o   "a?"	means: match 'a' 1 or 0	times

       o   "a*"	means: match 'a' 0 or more times, i.e.,	any number of times

       o   "a+"	means: match 'a' 1 or more times, i.e.,	at least once

       o   "a{n,m}" means: match at least "n" times, but not more than "m"
	   times.

       o   "a{n,}" means: match	at least "n" or	more times

       o   "a{n}" means: match exactly "n" times

       Here are	some examples:

	   /[a-z]+\s+\d*/;  # match a lowercase	word, at least one space, and
			    # any number of digits
	   /(\w+)\s+\g1/;    # match doubled words of arbitrary	length
	   /y(es)?/i;	    # matches 'y', 'Y',	or a case-insensitive 'yes'
	   $year =~ /^\d{2,4}$/;  # make sure year is at least 2 but not more
				  # than 4 digits
	   $year =~ /^\d{4}$|^\d{2}$/; # better	match; throw out 3-digit dates
	   $year =~ /^\d{2}(\d{2})?$/; # same thing written differently.
				       # However, this captures	the last two
				       # digits	in $1 and the other does not.

	   % simple_grep '^(\w+)\g1$' /usr/dict/words	# isn't	this easier?
	   beriberi
	   booboo
	   coco
	   mama
	   murmur
	   papa

       For all of these	quantifiers, Perl will try to match as much of the
       string as possible, while still allowing	the regexp to succeed.	Thus
       with "/a?.../", Perl will first try to match the	regexp with the	'a'
       present;	if that	fails, Perl will try to	match the regexp without the
       'a' present.  For the quantifier	'*', we	get the	following:

	   $x =	"the cat in the	hat";
	   $x =~ /^(.*)(cat)(.*)$/; # matches,
				    # $1 = 'the	'
				    # $2 = 'cat'
				    # $3 = ' in	the hat'

       Which is	what we	might expect, the match	finds the only "cat" in	the
       string and locks	onto it.  Consider, however, this regexp:

	   $x =~ /^(.*)(at)(.*)$/; # matches,
				   # $1	= 'the cat in the h'
				   # $2	= 'at'
				   # $3	= ''   (0 characters match)

       One might initially guess that Perl would find the "at" in "cat"	and
       stop there, but that wouldn't give the longest possible string to the
       first quantifier	".*".  Instead,	the first quantifier ".*" grabs	as
       much of the string as possible while still having the regexp match.  In
       this example, that means	having the "at"	sequence with the final	"at"
       in the string.  The other important principle illustrated here is that,
       when there are two or more elements in a	regexp,	the leftmost
       quantifier, if there is one, gets to grab as much of the	string as
       possible, leaving the rest of the regexp	to fight over scraps.  Thus in
       our example, the	first quantifier ".*" grabs most of the	string,	while
       the second quantifier ".*" gets the empty string.   Quantifiers that
       grab as much of the string as possible are called maximal match or
       greedy quantifiers.

       When a regexp can match a string	in several different ways, we can use
       the principles above to predict which way the regexp will match:

       o   Principle 0:	Taken as a whole, any regexp will be matched at	the
	   earliest possible position in the string.

       o   Principle 1:	In an alternation "a|b|c...", the leftmost alternative
	   that	allows a match for the whole regexp will be the	one used.

       o   Principle 2:	The maximal matching quantifiers '?', '*', '+' and
	   "{n,m}" will	in general match as much of the	string as possible
	   while still allowing	the whole regexp to match.

       o   Principle 3:	If there are two or more elements in a regexp, the
	   leftmost greedy quantifier, if any, will match as much of the
	   string as possible while still allowing the whole regexp to match.
	   The next leftmost greedy quantifier,	if any,	will try to match as
	   much	of the string remaining	available to it	as possible, while
	   still allowing the whole regexp to match.  And so on, until all the
	   regexp elements are satisfied.

       As we have seen above, Principle	0 overrides the	others.	The regexp
       will be matched as early	as possible, with the other principles
       determining how the regexp matches at that earliest character position.

       Here is an example of these principles in action:

	   $x =	"The programming republic of Perl";
	   $x =~ /^(.+)(e|r)(.*)$/;  # matches,
				     # $1 = 'The programming republic of Pe'
				     # $2 = 'r'
				     # $3 = 'l'

       This regexp matches at the earliest string position, 'T'.  One might
       think that 'e', being leftmost in the alternation, would	be matched,
       but 'r' produces	the longest string in the first	quantifier.

	   $x =~ /(m{1,2})(.*)$/;  # matches,
				   # $1	= 'mm'
				   # $2	= 'ing republic	of Perl'

       Here, The earliest possible match is at the first 'm' in	"programming".
       "m{1,2}"	is the first quantifier, so it gets to match a maximal "mm".

	   $x =~ /.*(m{1,2})(.*)$/;  # matches,
				     # $1 = 'm'
				     # $2 = 'ing republic of Perl'

       Here, the regexp	matches	at the start of	the string. The	first
       quantifier ".*" grabs as	much as	possible, leaving just a single	'm'
       for the second quantifier "m{1,2}".

	   $x =~ /(.?)(m{1,2})(.*)$/;  # matches,
				       # $1 = 'a'
				       # $2 = 'mm'
				       # $3 = 'ing republic of Perl'

       Here, ".?" eats its maximal one character at the	earliest possible
       position	in the string, 'a' in "programming", leaving "m{1,2}" the
       opportunity to match both 'm''s.	Finally,

	   "aXXXb" =~ /(X*)/; #	matches	with $1	= ''

       because it can match zero copies	of 'X' at the beginning	of the string.
       If you definitely want to match at least	one 'X', use "X+", not "X*".

       Sometimes greed is not good.  At	times, we would	like quantifiers to
       match a minimal piece of	string,	rather than a maximal piece.  For this
       purpose,	Larry Wall created the minimal match or	non-greedy quantifiers
       "??", "*?", "+?", and "{}?".  These are the usual quantifiers with a
       '?' appended to them.  They have	the following meanings:

       o   "a??" means:	match 'a' 0 or 1 times.	Try 0 first, then 1.

       o   "a*?" means:	match 'a' 0 or more times, i.e., any number of times,
	   but as few times as possible

       o   "a+?" means:	match 'a' 1 or more times, i.e., at least once,	but as
	   few times as	possible

       o   "a{n,m}?" means: match at least "n" times, not more than "m"	times,
	   as few times	as possible

       o   "a{n,}?" means: match at least "n" times, but as few	times as
	   possible

       o   "a{n}?" means: match	exactly	"n" times.  Because we match exactly
	   "n" times, "a{n}?" is equivalent to "a{n}" and is just there	for
	   notational consistency.

       Let's look at the example above,	but with minimal quantifiers:

	   $x =	"The programming republic of Perl";
	   $x =~ /^(.+?)(e|r)(.*)$/; # matches,
				     # $1 = 'Th'
				     # $2 = 'e'
				     # $3 = ' programming republic of Perl'

       The minimal string that will allow both the start of the	string '^' and
       the alternation to match	is "Th", with the alternation "e|r" matching
       'e'.  The second	quantifier ".*"	is free	to gobble up the rest of the
       string.

	   $x =~ /(m{1,2}?)(.*?)$/;  # matches,
				     # $1 = 'm'
				     # $2 = 'ming republic of Perl'

       The first string	position that this regexp can match is at the first
       'm' in "programming". At	this position, the minimal "m{1,2}?"  matches
       just one	'm'.  Although the second quantifier ".*?" would prefer	to
       match no	characters, it is constrained by the end-of-string anchor '$'
       to match	the rest of the	string.

	   $x =~ /(.*?)(m{1,2}?)(.*)$/;	 # matches,
					 # $1 =	'The progra'
					 # $2 =	'm'
					 # $3 =	'ming republic of Perl'

       In this regexp, you might expect	the first minimal quantifier ".*?"  to
       match the empty string, because it is not constrained by	a '^' anchor
       to match	the beginning of the word.  Principle 0	applies	here, however.
       Because it is possible for the whole regexp to match at the start of
       the string, it will match at the	start of the string.  Thus the first
       quantifier has to match everything up to	the first 'm'.	The second
       minimal quantifier matches just one 'm' and the third quantifier
       matches the rest	of the string.

	   $x =~ /(.??)(m{1,2})(.*)$/;	# matches,
					# $1 = 'a'
					# $2 = 'mm'
					# $3 = 'ing republic of	Perl'

       Just as in the previous regexp, the first quantifier ".??" can match
       earliest	at position 'a', so it does.  The second quantifier is greedy,
       so it matches "mm", and the third matches the rest of the string.

       We can modify principle 3 above to take into account non-greedy
       quantifiers:

       o   Principle 3:	If there are two or more elements in a regexp, the
	   leftmost greedy (non-greedy)	quantifier, if any, will match as much
	   (little) of the string as possible while still allowing the whole
	   regexp to match.  The next leftmost greedy (non-greedy) quantifier,
	   if any, will	try to match as	much (little) of the string remaining
	   available to	it as possible,	while still allowing the whole regexp
	   to match.  And so on, until all the regexp elements are satisfied.

       Just like alternation, quantifiers are also susceptible to
       backtracking.  Here is a	step-by-step analysis of the example

	   $x =	"the cat in the	hat";
	   $x =~ /^(.*)(at)(.*)$/; # matches,
				   # $1	= 'the cat in the h'
				   # $2	= 'at'
				   # $3	= ''   (0 matches)

       0.  Start with the first	letter in the string 't'.

       1.  The first quantifier	'.*' starts out	by matching the	whole string
       ""the cat in the	hat"".

       2.  'a' in the regexp element 'at' doesn't match	the end	of the string.
       Backtrack one character.

       3.  'a' in the regexp element 'at' still	doesn't	match the last letter
       of the string 't', so backtrack one more	character.

       4.  Now we can match the	'a' and	the 't'.

       5.  Move	on to the third	element	'.*'.  Since we	are at the end of the
       string and '.*' can match 0 times, assign it the	empty string.

       6.  We are done!

       Most of the time, all this moving forward and backtracking happens
       quickly and searching is	fast. There are	some pathological regexps,
       however,	whose execution	time exponentially grows with the size of the
       string.	A typical structure that blows up in your face is of the form

	   /(a|b+)*/;

       The problem is the nested indeterminate quantifiers.  There are many
       different ways of partitioning a	string of length n between the '+' and
       '*': one	repetition with	"b+" of	length n, two repetitions with the
       first "b+" length k and the second with length n-k, m repetitions whose
       bits add	up to length n,	etc.  In fact there are	an exponential number
       of ways to partition a string as	a function of its length.  A regexp
       may get lucky and match early in	the process, but if there is no	match,
       Perl will try every possibility before giving up.  So be	careful	with
       nested '*''s, "{n,m}"'s,	and '+''s.  The	book Mastering Regular
       Expressions by Jeffrey Friedl gives a wonderful discussion of this and
       other efficiency	issues.

   Possessive quantifiers
       Backtracking during the relentless search for a match may be a waste of
       time, particularly when the match is bound to fail.  Consider the
       simple pattern

	   /^\w+\s+\w+$/; # a word, spaces, a word

       Whenever	this is	applied	to a string which doesn't quite	meet the
       pattern's expectations such as "abc  " or "abc  def ", the regexp
       engine will backtrack, approximately once for each character in the
       string.	But we know that there is no way around	taking all of the
       initial word characters to match	the first repetition, that all spaces
       must be eaten by	the middle part, and the same goes for the second
       word.

       With the	introduction of	the possessive quantifiers in Perl 5.10, we
       have a way of instructing the regexp engine not to backtrack, with the
       usual quantifiers with a	'+' appended to	them.  This makes them greedy
       as well as stingy; once they succeed they won't give anything back to
       permit another solution.	They have the following	meanings:

       o   "a{n,m}+" means: match at least "n" times, not more than "m"	times,
	   as many times as possible, and don't	give anything up. "a?+"	is
	   short for "a{0,1}+"

       o   "a{n,}+" means: match at least "n" times, but as many times as
	   possible, and don't give anything up. "a*+" is short	for "a{0,}+"
	   and "a++" is	short for "a{1,}+".

       o   "a{n}+" means: match	exactly	"n" times.  It is just there for
	   notational consistency.

       These possessive	quantifiers represent a	special	case of	a more general
       concept,	the independent	subexpression, see below.

       As an example where a possessive	quantifier is suitable we consider
       matching	a quoted string, as it appears in several programming
       languages.  The backslash is used as an escape character	that indicates
       that the	next character is to be	taken literally, as another character
       for the string.	Therefore, after the opening quote, we expect a
       (possibly empty)	sequence of alternatives: either some character	except
       an unescaped quote or backslash or an escaped character.

	   /"(?:[^"\\]++|\\.)*+"/;

   Building a regexp
       At this point, we have all the basic regexp concepts covered, so	let's
       give a more involved example of a regular expression.  We will build a
       regexp that matches numbers.

       The first task in building a regexp is to decide	what we	want to	match
       and what	we want	to exclude.  In	our case, we want to match both
       integers	and floating point numbers and we want to reject any string
       that isn't a number.

       The next	task is	to break the problem down into smaller problems	that
       are easily converted into a regexp.

       The simplest case is integers.  These consist of	a sequence of digits,
       with an optional	sign in	front.	The digits we can represent with "\d+"
       and the sign can	be matched with	"[+-]".	 Thus the integer regexp is

	   /[+-]?\d+/;	# matches integers

       A floating point	number potentially has a sign, an integral part, a
       decimal point, a	fractional part, and an	exponent.  One or more of
       these parts is optional,	so we need to check out	the different
       possibilities.  Floating	point numbers which are	in proper form include
       123., 0.345, .34, -1e6, and 25.4E-72.  As with integers,	the sign out
       front is	completely optional and	can be matched by "[+-]?".  We can see
       that if there is	no exponent, floating point numbers must have a
       decimal point, otherwise	they are integers.  We might be	tempted	to
       model these with	"\d*\.\d*", but	this would also	match just a single
       decimal point, which is not a number.  So the three cases of floating
       point number without exponent are

	  /[+-]?\d+\./;	 # 1., 321., etc.
	  /[+-]?\.\d+/;	 # .1, .234, etc.
	  /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.

       These can be combined into a single regexp with a three-way
       alternation:

	  /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent

       In this alternation, it is important to put '\d+\.\d+' before '\d+\.'.
       If '\d+\.' were first, the regexp would happily match that and ignore
       the fractional part of the number.

       Now consider floating point numbers with	exponents.  The	key
       observation here	is that	both integers and numbers with decimal points
       are allowed in front of an exponent.  Then exponents, like the overall
       sign, are independent of	whether	we are matching	numbers	with or
       without decimal points, and can be "decoupled" from the mantissa.  The
       overall form of the regexp now becomes clear:

	   /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;

       The exponent is an 'e' or 'E', followed by an integer.  So the exponent
       regexp is

	  /[eE][+-]?\d+/;  # exponent

       Putting all the parts together, we get a	regexp that matches numbers:

	  /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/;  # Ta da!

       Long regexps like this may impress your friends,	but can	be hard	to
       decipher.  In complex situations	like this, the "/x" modifier for a
       match is	invaluable.  It	allows one to put nearly arbitrary whitespace
       and comments into a regexp without affecting their meaning.  Using it,
       we can rewrite our "extended" regexp in the more	pleasing form

	  /^
	     [+-]?	   # first, match an optional sign
	     (		   # then match	integers or f.p. mantissas:
		 \d+\.\d+  # mantissa of the form a.b
		|\d+\.	   # mantissa of the form a.
		|\.\d+	   # mantissa of the form .b
		|\d+	   # integer of	the form a
	     )
	     ( [eE] [+-]? \d+ )?  # finally, optionally	match an exponent
	  $/x;

       If whitespace is	mostly irrelevant, how does one	include	space
       characters in an	extended regexp? The answer is to backslash it '\ ' or
       put it in a character class "[ ]".  The same thing goes for pound
       signs: use "\#" or "[#]".  For instance,	Perl allows a space between
       the sign	and the	mantissa or integer, and we could add this to our
       regexp as follows:

	  /^
	     [+-]?\ *	   # first, match an optional sign *and	space*
	     (		   # then match	integers or f.p. mantissas:
		 \d+\.\d+  # mantissa of the form a.b
		|\d+\.	   # mantissa of the form a.
		|\.\d+	   # mantissa of the form .b
		|\d+	   # integer of	the form a
	     )
	     ( [eE] [+-]? \d+ )?  # finally, optionally	match an exponent
	  $/x;

       In this form, it	is easier to see a way to simplify the alternation.
       Alternatives 1, 2, and 4	all start with "\d+", so it could be factored
       out:

	  /^
	     [+-]?\ *	   # first, match an optional sign
	     (		   # then match	integers or f.p. mantissas:
		 \d+	   # start out with a ...
		 (
		     \.\d* # mantissa of the form a.b or a.
		 )?	   # ? takes care of integers of the form a
		|\.\d+	   # mantissa of the form .b
	     )
	     ( [eE] [+-]? \d+ )?  # finally, optionally	match an exponent
	  $/x;

       Starting	in Perl	v5.26, specifying "/xx"	changes	the square-bracketed
       portions	of a pattern to	ignore tabs and	space characters unless	they
       are escaped by preceding	them with a backslash.	So, we could write

	  /^
	     [ + - ]?\ *   # first, match an optional sign
	     (		   # then match	integers or f.p. mantissas:
		 \d+	   # start out with a ...
		 (
		     \.\d* # mantissa of the form a.b or a.
		 )?	   # ? takes care of integers of the form a
		|\.\d+	   # mantissa of the form .b
	     )
	     ( [ e E ] [ + - ]?	\d+ )?	# finally, optionally match an exponent
	  $/xx;

       This doesn't really improve the legibility of this example, but it's
       available in case you want it.  Squashing the pattern down to the
       compact form, we	have

	   /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;

       This is our final regexp.  To recap, we built a regexp by

       o   specifying the task in detail,

       o   breaking down the problem into smaller parts,

       o   translating the small parts into regexps,

       o   combining the regexps,

       o   and optimizing the final combined regexp.

       These are also the typical steps	involved in writing a computer
       program.	 This makes perfect sense, because regular expressions are
       essentially programs written in a little	computer language that
       specifies patterns.

   Using regular expressions in	Perl
       The last	topic of Part 1	briefly	covers how regexps are used in Perl
       programs.  Where	do they	fit into Perl syntax?

       We have already introduced the matching operator	in its default
       "/regexp/" and arbitrary	delimiter "m!regexp!" forms.  We have used the
       binding operator	"=~" and its negation "!~" to test for string matches.
       Associated with the matching operator, we have discussed	the single
       line "/s", multi-line "/m", case-insensitive "/i" and extended "/x"
       modifiers.  There are a few more	things you might want to know about
       matching	operators.

       Prohibiting substitution

       If you change $pattern after the	first substitution happens, Perl will
       ignore it.  If you don't	want any substitutions at all, use the special
       delimiter "m''":

	   @pattern = ('Seuss');
	   while (<>) {
	       print if	m'@pattern';  #	matches	literal	'@pattern', not	'Seuss'
	   }

       Similar to strings, "m''" acts like apostrophes on a regexp; all	other
       'm' delimiters act like quotes.	If the regexp evaluates	to the empty
       string, the regexp in the last successful match is used instead.	 So we
       have

	   "dog" =~ /d/;  # 'd'	matches
	   "dogbert =~ //;  # this matches the 'd' regexp used before

       Global matching

       The final two modifiers we will discuss here, "/g" and "/c", concern
       multiple	matches.  The modifier "/g" stands for global matching and
       allows the matching operator to match within a string as	many times as
       possible.  In scalar context, successive	invocations against a string
       will have "/g" jump from	match to match,	keeping	track of position in
       the string as it	goes along.  You can get or set	the position with the
       "pos()" function.

       The use of "/g" is shown	in the following example.  Suppose we have a
       string that consists of words separated by spaces.  If we know how many
       words there are in advance, we could extract the	words using groupings:

	   $x =	"cat dog house"; # 3 words
	   $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
						  # $1 = 'cat'
						  # $2 = 'dog'
						  # $3 = 'house'

       But what	if we had an indeterminate number of words? This is the	sort
       of task "/g" was	made for.  To extract all words, form the simple
       regexp "(\w+)" and loop over all	matches	with "/(\w+)/g":

	   while ($x =~	/(\w+)/g) {
	       print "Word is $1, ends at position ", pos $x, "\n";
	   }

       prints

	   Word	is cat,	ends at	position 3
	   Word	is dog,	ends at	position 7
	   Word	is house, ends at position 13

       A failed	match or changing the target string resets the position.  If
       you don't want the position reset after failure to match, add the "/c",
       as in "/regexp/gc".  The	current	position in the	string is associated
       with the	string,	not the	regexp.	 This means that different strings
       have different positions	and their respective positions can be set or
       read independently.

       In list context,	"/g" returns a list of matched groupings, or if	there
       are no groupings, a list	of matches to the whole	regexp.	 So if we
       wanted just the words, we could use

	   @words = ($x	=~ /(\w+)/g);  # matches,
				       # $words[0] = 'cat'
				       # $words[1] = 'dog'
				       # $words[2] = 'house'

       Closely associated with the "/g"	modifier is the	"\G" anchor.  The "\G"
       anchor matches at the point where the previous "/g" match left off.
       "\G" allows us to easily	do context-sensitive matching:

	   $metric = 1;	 # use metric units
	   ...
	   $x =	<FILE>;	 # read	in measurement
	   $x =~ /^([+-]?\d+)\s*/g;  # get magnitude
	   $weight = $1;
	   if ($metric)	{ # error checking
	       print "Units error!" unless $x =~ /\Gkg\./g;
	   }
	   else	{
	       print "Units error!" unless $x =~ /\Glbs\./g;
	   }
	   $x =~ /\G\s+(widget|sprocket)/g;  # continue	processing

       The combination of "/g" and "\G"	allows us to process the string	a bit
       at a time and use arbitrary Perl	logic to decide	what to	do next.
       Currently, the "\G" anchor is only fully	supported when used to anchor
       to the start of the pattern.

       "\G" is also invaluable in processing fixed-length records with
       regexps.	 Suppose we have a snippet of coding region DNA, encoded as
       base pair letters "ATCGTTGAAT..." and we	want to	find all the stop
       codons "TGA".  In a coding region, codons are 3-letter sequences, so we
       can think of the	DNA snippet as a sequence of 3-letter records.	The
       naive regexp

	   # expanded, this is "ATC GTT	GAA TGC	AAA TGA	CAT GAC"
	   $dna	= "ATCGTTGAATGCAAATGACATGAC";
	   $dna	=~ /TGA/;

       doesn't work; it	may match a "TGA", but there is	no guarantee that the
       match is	aligned	with codon boundaries, e.g., the substring "GTT	GAA"
       gives a match.  A better	solution is

	   while ($dna =~ /(\w\w\w)*?TGA/g) {  # note the minimal *?
	       print "Got a TGA	stop codon at position ", pos $dna, "\n";
	   }

       which prints

	   Got a TGA stop codon	at position 18
	   Got a TGA stop codon	at position 23

       Position	18 is good, but	position 23 is bogus.  What happened?

       The answer is that our regexp works well	until we get past the last
       real match.  Then the regexp will fail to match a synchronized "TGA"
       and start stepping ahead	one character position at a time, not what we
       want.  The solution is to use "\G" to anchor the	match to the codon
       alignment:

	   while ($dna =~ /\G(\w\w\w)*?TGA/g) {
	       print "Got a TGA	stop codon at position ", pos $dna, "\n";
	   }

       This prints

	   Got a TGA stop codon	at position 18

       which is	the correct answer.  This example illustrates that it is
       important not only to match what	is desired, but	to reject what is not
       desired.

       (There are other	regexp modifiers that are available, such as "/o", but
       their specialized uses are beyond the scope of this introduction.  )

       Search and replace

       Regular expressions also	play a big role	in search and replace
       operations in Perl.  Search and replace is accomplished with the	"s///"
       operator.  The general form is "s/regexp/replacement/modifiers",	with
       everything we know about	regexps	and modifiers applying in this case as
       well.  The replacement is a Perl	double-quoted string that replaces in
       the string whatever is matched with the "regexp".  The operator "=~" is
       also used here to associate a string with "s///".  If matching against
       $_, the "$_ =~" can be dropped.	If there is a match, "s///" returns
       the number of substitutions made; otherwise it returns false.  Here are
       a few examples:

	   $x =	"Time to feed the cat!";
	   $x =~ s/cat/hacker/;	  # $x contains	"Time to feed the hacker!"
	   if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
	       $more_insistent = 1;
	   }
	   $y =	"'quoted words'";
	   $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
				  # $y contains	"quoted	words"

       In the last example, the	whole string was matched, but only the part
       inside the single quotes	was grouped.  With the "s///" operator,	the
       matched variables $1, $2, etc. are immediately available	for use	in the
       replacement expression, so we use $1 to replace the quoted string with
       just what was quoted.  With the global modifier,	"s///g"	will search
       and replace all occurrences of the regexp in the	string:

	   $x =	"I batted 4 for	4";
	   $x =~ s/4/four/;   #	doesn't	do it all:
			      #	$x contains "I batted four for 4"
	   $x =	"I batted 4 for	4";
	   $x =~ s/4/four/g;  #	does it	all:
			      #	$x contains "I batted four for four"

       If you prefer "regex" over "regexp" in this tutorial, you could use the
       following program to replace it:

	   % cat > simple_replace
	   #!/usr/bin/perl
	   $regexp = shift;
	   $replacement	= shift;
	   while (<>) {
	       s/$regexp/$replacement/g;
	       print;
	   }
	   ^D

	   % simple_replace regexp regex perlretut.pod

       In "simple_replace" we used the "s///g" modifier	to replace all
       occurrences of the regexp on each line.	(Even though the regular
       expression appears in a loop, Perl is smart enough to compile it	only
       once.)  As with "simple_grep", both the "print" and the
       "s/$regexp/$replacement/g" use $_ implicitly.

       If you don't want "s///"	to change your original	variable you can use
       the non-destructive substitute modifier,	"s///r".  This changes the
       behavior	so that	"s///r"	returns	the final substituted string (instead
       of the number of	substitutions):

	   $x =	"I like	dogs.";
	   $y =	$x =~ s/dogs/cats/r;
	   print "$x $y\n";

       That example will print "I like dogs. I like cats". Notice the original
       $x variable has not been	affected. The overall result of	the
       substitution is instead stored in $y. If	the substitution doesn't
       affect anything then the	original string	is returned:

	   $x =	"I like	dogs.";
	   $y =	$x =~ s/elephants/cougars/r;
	   print "$x $y\n"; # prints "I	like dogs. I like dogs."

       One other interesting thing that	the "s///r" flag allows	is chaining
       substitutions:

	   $x =	"Cats are great.";
	   print $x =~ s/Cats/Dogs/r =~	s/Dogs/Frogs/r =~
	       s/Frogs/Hedgehogs/r, "\n";
	   # prints "Hedgehogs are great."

       A modifier available specifically to search and replace is the "s///e"
       evaluation modifier.  "s///e" treats the	replacement text as Perl code,
       rather than a double-quoted string.  The	value that the code returns is
       substituted for the matched substring.  "s///e" is useful if you	need
       to do a bit of computation in the process of replacing text.  This
       example counts character	frequencies in a line:

	   $x =	"Bill the cat";
	   $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
	   print "frequency of '$_' is $chars{$_}\n"
	       foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);

       This prints

	   frequency of	' ' is 2
	   frequency of	't' is 2
	   frequency of	'l' is 2
	   frequency of	'B' is 1
	   frequency of	'c' is 1
	   frequency of	'e' is 1
	   frequency of	'h' is 1
	   frequency of	'i' is 1
	   frequency of	'a' is 1

       As with the match "m//" operator, "s///"	can use	other delimiters, such
       as "s!!!" and "s{}{}", and even "s{}//".	 If single quotes are used
       "s'''", then the	regexp and replacement are treated as single-quoted
       strings and there are no	variable substitutions.	 "s///"	in list
       context returns the same	thing as in scalar context, i.e., the number
       of matches.

       The split function

       The "split()" function is another place where a regexp is used.	"split
       /regexp/, string, limit"	separates the "string" operand into a list of
       substrings and returns that list.  The regexp must be designed to match
       whatever	constitutes the	separators for the desired substrings.	The
       "limit",	if present, constrains splitting into no more than "limit"
       number of strings.  For example,	to split a string into words, use

	   $x =	"Calvin	and Hobbes";
	   @words = split /\s+/, $x;  #	$word[0] = 'Calvin'
				      #	$word[1] = 'and'
				      #	$word[2] = 'Hobbes'

       If the empty regexp "//"	is used, the regexp always matches and the
       string is split into individual characters.  If the regexp has
       groupings, then the resulting list contains the matched substrings from
       the groupings as	well.  For instance,

	   $x =	"/usr/bin/perl";
	   @dirs = split m!/!, $x;  # $dirs[0] = ''
				    # $dirs[1] = 'usr'
				    # $dirs[2] = 'bin'
				    # $dirs[3] = 'perl'
	   @parts = split m!(/)!, $x;  # $parts[0] = ''
				       # $parts[1] = '/'
				       # $parts[2] = 'usr'
				       # $parts[3] = '/'
				       # $parts[4] = 'bin'
				       # $parts[5] = '/'
				       # $parts[6] = 'perl'

       Since the first character of $x matched the regexp, "split" prepended
       an empty	initial	element	to the list.

       If you have read	this far, congratulations! You now have	all the	basic
       tools needed to use regular expressions to solve	a wide range of	text
       processing problems.  If	this is	your first time	through	the tutorial,
       why not stop here and play around with regexps a	while....  Part	2
       concerns	the more esoteric aspects of regular expressions and those
       concepts	certainly aren't needed	right at the start.

Part 2:	Power tools
       OK, you know the	basics of regexps and you want to know more.  If
       matching	regular	expressions is analogous to a walk in the woods, then
       the tools discussed in Part 1 are analogous to topo maps	and a compass,
       basic tools we use all the time.	 Most of the tools in part 2 are
       analogous to flare guns and satellite phones.  They aren't used too
       often on	a hike,	but when we are	stuck, they can	be invaluable.

       What follows are	the more advanced, less	used, or sometimes esoteric
       capabilities of Perl regexps.  In Part 2, we will assume	you are
       comfortable with	the basics and concentrate on the advanced features.

   More	on characters, strings,	and character classes
       There are a number of escape sequences and character classes that we
       haven't covered yet.

       There are several escape	sequences that convert characters or strings
       between upper and lower case, and they are also available within
       patterns.  "\l" and "\u"	convert	the next character to lower or upper
       case, respectively:

	   $x =	"perl";
	   $string =~ /\u$x/;  # matches 'Perl'	in $string
	   $x =	"M(rs?|s)\\."; # note the double backslash
	   $string =~ /\l$x/;  # matches 'mr.',	'mrs.',	and 'ms.',

       A "\L" or "\U" indicates	a lasting conversion of	case, until terminated
       by "\E" or thrown over by another "\U" or "\L":

	   $x =	"This word is in lower case:\L SHOUT\E";
	   $x =~ /shout/;	# matches
	   $x =	"I STILL KEYPUNCH CARDS	FOR MY 360"
	   $x =~ /\Ukeypunch/;	# matches punch	card string

       If there	is no "\E", case is converted until the	end of the string. The
       regexps "\L\u$word" or "\u\L$word" convert the first character of $word
       to uppercase and	the rest of the	characters to lowercase.

       Control characters can be escaped with "\c", so that a control-Z
       character would be matched with "\cZ".  The escape sequence "\Q"..."\E"
       quotes, or protects most	non-alphabetic characters.   For instance,

	   $x =	"\QThat	!^*&%~&	cat!";
	   $x =~ /\Q!^*&%~&\E/;	 # check for rough language

       It does not protect '$' or '@', so that variables can still be
       substituted.

       "\Q", "\L", "\l", "\U", "\u" and	"\E" are actually part of double-
       quotish syntax, and not part of regexp syntax proper.  They will	work
       if they appear in a regular expression embedded directly	in a program,
       but not when contained in a string that is interpolated in a pattern.

       Perl regexps can	handle more than just the standard ASCII character
       set.  Perl supports Unicode, a standard for representing	the alphabets
       from virtually all of the world's written languages, and	a host of
       symbols.	 Perl's	text strings are Unicode strings, so they can contain
       characters with a value (codepoint or character number) higher than
       255.

       What does this mean for regexps?	Well, regexp users don't need to know
       much about Perl's internal representation of strings.  But they do need
       to know 1) how to represent Unicode characters in a regexp and 2) that
       a matching operation will treat the string to be	searched as a sequence
       of characters, not bytes.  The answer to	1) is that Unicode characters
       greater than "chr(255)" are represented using the "\x{hex}" notation,
       because "\x"XY (without curly braces and	XY are two hex digits) doesn't
       go further than 255.  (Starting in Perl 5.14, if	you're an octal	fan,
       you can also use	"\o{oct}".)

	   /\x{263a}/;	# match	a Unicode smiley face :)

       NOTE: In	Perl 5.6.0 it used to be that one needed to say	"use utf8" to
       use any Unicode features.  This is no more the case: for	almost all
       Unicode processing, the explicit	"utf8" pragma is not needed.  (The
       only case where it matters is if	your Perl script is in Unicode and
       encoded in UTF-8, then an explicit "use utf8" is	needed.)

       Figuring	out the	hexadecimal sequence of	a Unicode character you	want
       or deciphering someone else's hexadecimal Unicode regexp	is about as
       much fun	as programming in machine code.	 So another way	to specify
       Unicode characters is to	use the	named character	escape sequence
       "\N{name}".  name is a name for the Unicode character, as specified in
       the Unicode standard.  For instance, if we wanted to represent or match
       the astrological	sign for the planet Mercury, we	could use

	   $x =	"abc\N{MERCURY}def";
	   $x =~ /\N{MERCURY}/;	  # matches

       One can also use	"short"	names:

	   print "\N{GREEK SMALL LETTER	SIGMA} is called sigma.\n";
	   print "\N{greek:Sigma} is an	upper-case sigma.\n";

       You can also restrict names to a	certain	alphabet by specifying the
       charnames pragma:

	   use charnames qw(greek);
	   print "\N{sigma} is Greek sigma\n";

       An index	of character names is available	on-line	from the Unicode
       Consortium, <http://www.unicode.org/charts/charindex.html>; explanatory
       material	with links to other resources at
       <http://www.unicode.org/standard/where>.

       The answer to requirement 2) is that a regexp (mostly) uses Unicode
       characters.  The	"mostly" is for	messy backward compatibility reasons,
       but starting in Perl 5.14, any regexp compiled in the scope of a	"use
       feature 'unicode_strings'" (which is automatically turned on within the
       scope of	a "use 5.012" or higher) will turn that	"mostly" into
       "always".  If you want to handle	Unicode	properly, you should ensure
       that 'unicode_strings' is turned	on.  Internally, this is encoded to
       bytes using either UTF-8	or a native 8 bit encoding, depending on the
       history of the string, but conceptually it is a sequence	of characters,
       not bytes. See perlunitut for a tutorial	about that.

       Let us now discuss Unicode character classes, most usually called
       "character properties".	These are represented by the "\p{name}"	escape
       sequence.  The negation of this is "\P{name}".  For example, to match
       lower and uppercase characters,

	   $x =	"BOB";
	   $x =~ /^\p{IsUpper}/;   # matches, uppercase	char class
	   $x =~ /^\P{IsUpper}/;   # doesn't match, char class sans uppercase
	   $x =~ /^\p{IsLower}/;   # doesn't match, lowercase char class
	   $x =~ /^\P{IsLower}/;   # matches, char class sans lowercase

       (The ""Is"" is optional.)

       There are many, many Unicode character properties.  For the full	list
       see perluniprops.  Most of them have synonyms with shorter names, also
       listed there.  Some synonyms are	a single character.  For these,	you
       can drop	the braces.  For instance, "\pM" is the	same thing as
       "\p{Mark}", meaning things like accent marks.

       The Unicode "\p{Script}"	and "\p{Script_Extensions}" properties are
       used to categorize every	Unicode	character into the language script it
       is written in.  ("Script_Extensions" is an improved version of
       "Script", which is retained for backward	compatibility, and so you
       should generally	use "Script_Extensions".)  For example,	English,
       French, and a bunch of other European languages are written in the
       Latin script.  But there	is also	the Greek script, the Thai script, the
       Katakana	script,	etc.  You can test whether a character is in a
       particular script (based	on "Script_Extensions")	with, for example
       "\p{Latin}", "\p{Greek}", or "\p{Katakana}".  To	test if	it isn't in
       the Balinese script, you	would use "\P{Balinese}".

       What we have described so far is	the single form	of the "\p{...}"
       character classes.  There is also a compound form which you may run
       into.  These look like "\p{name=value}" or "\p{name:value}" (the	equals
       sign and	colon can be used interchangeably).  These are more general
       than the	single form, and in fact most of the single forms are just
       Perl-defined shortcuts for common compound forms.  For example, the
       script examples in the previous paragraph could be written equivalently
       as "\p{Script_Extensions=Latin}", "\p{Script_Extensions:Greek}",
       "\p{script_extensions=katakana}", and "\P{script_extensions=balinese}"
       (case is	irrelevant between the "{}" braces).  You may never have to
       use the compound	forms, but sometimes it	is necessary, and their	use
       can make	your code easier to understand.

       "\X" is an abbreviation for a character class that comprises a Unicode
       extended	grapheme cluster.  This	represents a "logical character": what
       appears to be a single character, but may be represented	internally by
       more than one.  As an example, using the	Unicode	full names, e.g.,
       "A + COMBINING RING" is a grapheme cluster with base character "A" and
       combining character "COMBINING RING, which translates in	Danish to "A"
       with the	circle atop it,	as in the word Aangstrom.

       For the full and	latest information about Unicode see the latest
       Unicode standard, or the	Unicode	Consortium's website
       <http://www.unicode.org>

       As if all those classes weren't enough, Perl also defines POSIX-style
       character classes.  These have the form "[:name:]", with	name the name
       of the POSIX class.  The	POSIX classes are "alpha", "alnum", "ascii",
       "cntrl",	"digit", "graph", "lower", "print", "punct", "space", "upper",
       and "xdigit", and two extensions, "word"	(a Perl	extension to match
       "\w"), and "blank" (a GNU extension).  The "/a" modifier	restricts
       these to	matching just in the ASCII range; otherwise they can match the
       same as their corresponding Perl	Unicode	classes: "[:upper:]" is	the
       same as "\p{IsUpper}", etc.  (There are some exceptions and gotchas
       with this; see perlrecharclass for a full discussion.) The "[:digit:]",
       "[:word:]", and "[:space:]" correspond to the familiar "\d", "\w", and
       "\s" character classes.	To negate a POSIX class, put a '^' in front of
       the name, so that, e.g.,	"[:^digit:]" corresponds to "\D" and, under
       Unicode,	"\P{IsDigit}".	The Unicode and	POSIX character	classes	can be
       used just like "\d", with the exception that POSIX character classes
       can only	be used	inside of a character class:

	   /\s+[abc[:digit:]xyz]\s*/;  # match a,b,c,x,y,z, or a digit
	   /^=item\s[[:digit:]]/;      # match '=item',
				       # followed by a space and a digit
	   /\s+[abc\p{IsDigit}xyz]\s+/;	 # match a,b,c,x,y,z, or a digit
	   /^=item\s\p{IsDigit}/;	 # match '=item',
					 # followed by a space and a digit

       Whew! That is all the rest of the characters and	character classes.

   Compiling and saving	regular	expressions
       In Part 1 we mentioned that Perl	compiles a regexp into a compact
       sequence	of opcodes.  Thus, a compiled regexp is	a data structure that
       can be stored once and used again and again.  The regexp	quote "qr//"
       does exactly that: "qr/string/" compiles	the "string" as	a regexp and
       transforms the result into a form that can be assigned to a variable:

	   $reg	= qr/foo+bar?/;	 # reg contains	a compiled regexp

       Then $reg can be	used as	a regexp:

	   $x =	"fooooba";
	   $x =~ $reg;	   # matches, just like	/foo+bar?/
	   $x =~ /$reg/;   # same thing, alternate form

       $reg can	also be	interpolated into a larger regexp:

	   $x =~ /(abc)?$reg/;	# still	matches

       As with the matching operator, the regexp quote can use different
       delimiters, e.g., "qr!!", "qr{}"	or "qr~~".  Apostrophes	as delimiters
       ("qr''")	inhibit	any interpolation.

       Pre-compiled regexps are	useful for creating dynamic matches that don't
       need to be recompiled each time they are	encountered.  Using pre-
       compiled	regexps, we write a "grep_step"	program	which greps for	a
       sequence	of patterns, advancing to the next pattern as soon as one has
       been satisfied.

	   % cat > grep_step
	   #!/usr/bin/perl
	   # grep_step - match <number>	regexps, one after the other
	   # usage: multi_grep <number>	regexp1	regexp2	... file1 file2	...

	   $number = shift;
	   $regexp[$_] = shift foreach (0..$number-1);
	   @compiled = map qr/$_/, @regexp;
	   while ($line	= <>) {
	       if ($line =~ /$compiled[0]/) {
		   print $line;
		   shift @compiled;
		   last	unless @compiled;
	       }
	   }
	   ^D

	   % grep_step 3 shift print last grep_step
	   $number = shift;
		   print $line;
		   last	unless @compiled;

       Storing pre-compiled regexps in an array	@compiled allows us to simply
       loop through the	regexps	without	any recompilation, thus	gaining
       flexibility without sacrificing speed.

   Composing regular expressions at runtime
       Backtracking is more efficient than repeated tries with different
       regular expressions.  If	there are several regular expressions and a
       match with any of them is acceptable, then it is	possible to combine
       them into a set of alternatives.	 If the	individual expressions are
       input data, this	can be done by programming a join operation.  We'll
       exploit this idea in an improved	version	of the "simple_grep" program:
       a program that matches multiple patterns:

	   % cat > multi_grep
	   #!/usr/bin/perl
	   # multi_grep	- match	any of <number>	regexps
	   # usage: multi_grep <number>	regexp1	regexp2	... file1 file2	...

	   $number = shift;
	   $regexp[$_] = shift foreach (0..$number-1);
	   $pattern = join '|',	@regexp;

	   while ($line	= <>) {
	       print $line if $line =~ /$pattern/;
	   }
	   ^D

	   % multi_grep	2 shift	for multi_grep
	   $number = shift;
	   $regexp[$_] = shift foreach (0..$number-1);

       Sometimes it is advantageous to construct a pattern from	the input that
       is to be	analyzed and use the permissible values	on the left hand side
       of the matching operations.  As an example for this somewhat
       paradoxical situation, let's assume that	our input contains a command
       verb which should match one out of a set	of available command verbs,
       with the	additional twist that commands may be abbreviated as long as
       the given string	is unique. The program below demonstrates the basic
       algorithm.

	   % cat > keymatch
	   #!/usr/bin/perl
	   $kwds = 'copy compare list print';
	   while( $cmd = <> ){
	       $cmd =~ s/^\s+|\s+$//g;	# trim leading and trailing spaces
	       if( ( @matches =	$kwds =~ /\b$cmd\w*/g )	== 1 ){
		   print "command: '@matches'\n";
	       } elsif(	@matches == 0 ){
		   print "no such command: '$cmd'\n";
	       } else {
		   print "not unique: '$cmd' (could be one of: @matches)\n";
	       }
	   }
	   ^D

	   % keymatch
	   li
	   command: 'list'
	   co
	   not unique: 'co' (could be one of: copy compare)
	   printer
	   no such command: 'printer'

       Rather than trying to match the input against the keywords, we match
       the combined set	of keywords against the	input.	The pattern matching
       operation "$kwds	=~ /\b($cmd\w*)/g" does	several	things at the same
       time. It	makes sure that	the given command begins where a keyword
       begins ("\b"). It tolerates abbreviations due to	the added "\w*". It
       tells us	the number of matches ("scalar @matches") and all the keywords
       that were actually matched.  You	could hardly ask for more.

   Embedding comments and modifiers in a regular expression
       Starting	with this section, we will be discussing Perl's	set of
       extended	patterns.  These are extensions	to the traditional regular
       expression syntax that provide powerful new tools for pattern matching.
       We have already seen extensions in the form of the minimal matching
       constructs "??",	"*?", "+?", "{n,m}?", and "{n,}?".  Most of the
       extensions below	have the form "(?char...)", where the "char" is	a
       character that determines the type of extension.

       The first extension is an embedded comment "(?#text)".  This embeds a
       comment into the	regular	expression without affecting its meaning.  The
       comment should not have any closing parentheses in the text.  An
       example is

	   /(?#	Match an integer:)[+-]?\d+/;

       This style of commenting	has been largely superseded by the raw,
       freeform	commenting that	is allowed with	the "/x" modifier.

       Most modifiers, such as "/i", "/m", "/s"	and "/x" (or any combination
       thereof)	can also be embedded in	a regexp using "(?i)", "(?m)", "(?s)",
       and "(?x)".  For	instance,

	   /(?i)yes/;  # match 'yes' case insensitively
	   /yes/i;     # same thing
	   /(?x)(	   # freeform version of an integer regexp
		    [+-]?  # match an optional sign
		    \d+	   # match a sequence of digits
		)
	   /x;

       Embedded	modifiers can have two important advantages over the usual
       modifiers.  Embedded modifiers allow a custom set of modifiers for each
       regexp pattern.	This is	great for matching an array of regexps that
       must have different modifiers:

	   $pattern[0] = '(?i)doctor';
	   $pattern[1] = 'Johnson';
	   ...
	   while (<>) {
	       foreach $patt (@pattern)	{
		   print if /$patt/;
	       }
	   }

       The second advantage is that embedded modifiers (except "/p", which
       modifies	the entire regexp) only	affect the regexp inside the group the
       embedded	modifier is contained in.  So grouping can be used to localize
       the modifier's effects:

	   /Answer: ((?i)yes)/;	 # matches 'Answer: yes', 'Answer: YES', etc.

       Embedded	modifiers can also turn	off any	modifiers already present by
       using, e.g., "(?-i)".  Modifiers	can also be combined into a single
       expression, e.g., "(?s-i)" turns	on single line mode and	turns off case
       insensitivity.

       Embedded	modifiers may also be added to a non-capturing grouping.
       "(?i-m:regexp)" is a non-capturing grouping that	matches	"regexp" case
       insensitively and turns off multi-line mode.

   Looking ahead and looking behind
       This section concerns the lookahead and lookbehind assertions.  First,
       a little	background.

       In Perl regular expressions, most regexp	elements "eat up" a certain
       amount of string	when they match.  For instance,	the regexp element
       "[abc]" eats up one character of	the string when	it matches, in the
       sense that Perl moves to	the next character position in the string
       after the match.	 There are some	elements, however, that	don't eat up
       characters (advance the character position) if they match.  The
       examples	we have	seen so	far are	the anchors.  The anchor '^' matches
       the beginning of	the line, but doesn't eat any characters.  Similarly,
       the word	boundary anchor	"\b" matches wherever a	character matching
       "\w" is next to a character that	doesn't, but it	doesn't	eat up any
       characters itself.  Anchors are examples	of zero-width assertions:
       zero-width, because they	consume	no characters, and assertions, because
       they test some property of the string.  In the context of our walk in
       the woods analogy to regexp matching, most regexp elements move us
       along a trail, but anchors have us stop a moment	and check our
       surroundings.  If the local environment checks out, we can proceed
       forward.	 But if	the local environment doesn't satisfy us, we must
       backtrack.

       Checking	the environment	entails	either looking ahead on	the trail,
       looking behind, or both.	 '^' looks behind, to see that there are no
       characters before.  '$' looks ahead, to see that	there are no
       characters after.  "\b" looks both ahead	and behind, to see if the
       characters on either side differ	in their "word-ness".

       The lookahead and lookbehind assertions are generalizations of the
       anchor concept.	Lookahead and lookbehind are zero-width	assertions
       that let	us specify which characters we want to test for.  The
       lookahead assertion is denoted by "(?=regexp)" and the lookbehind
       assertion is denoted by "(?<=fixed-regexp)".  Some examples are

	   $x =	"I catch the housecat 'Tom-cat'	with catnip";
	   $x =~ /cat(?=\s)/;	# matches 'cat'	in 'housecat'
	   @catwords = ($x =~ /(?<=\s)cat\w+/g);  # matches,
						  # $catwords[0] = 'catch'
						  # $catwords[1] = 'catnip'
	   $x =~ /\bcat\b/;  # matches 'cat' in	'Tom-cat'
	   $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat'	in
				     # middle of $x

       Note that the parentheses in "(?=regexp)" and "(?<=regexp)" are non-
       capturing, since	these are zero-width assertions.  Thus in the second
       regexp, the substrings captured are those of the	whole regexp itself.
       Lookahead "(?=regexp)" can match	arbitrary regexps, but lookbehind
       "(?<=fixed-regexp)" only	works for regexps of fixed width, i.e.,	a
       fixed number of characters long.	 Thus "(?<=(ab|bc))" is	fine, but
       "(?<=(ab)*)" is not.  The negated versions of the lookahead and
       lookbehind assertions are denoted by "(?!regexp)" and
       "(?<!fixed-regexp)" respectively.  They evaluate	true if	the regexps do
       not match:

	   $x =	"foobar";
	   $x =~ /foo(?!bar)/;	# doesn't match, 'bar' follows 'foo'
	   $x =~ /foo(?!baz)/;	# matches, 'baz' doesn't follow	'foo'
	   $x =~ /(?<!\s)foo/;	# matches, there is no \s before 'foo'

       Here is an example where	a string containing blank-separated words,
       numbers and single dashes is to be split	into its components.  Using
       "/\s+/" alone won't work, because spaces	are not	required between
       dashes, or a word or a dash. Additional places for a split are
       established by looking ahead and	behind:

	   $str	= "one two - --6-8";
	   @toks = split / \s+		    # a	run of spaces
			 | (?<=\S) (?=-)    # any non-space followed by	'-'
			 | (?<=-)  (?=\S)   # a	'-' followed by	any non-space
			 /x, $str;	    # @toks = qw(one two - - - 6 - 8)

   Using independent subexpressions to prevent backtracking
       Independent subexpressions are regular expressions, in the context of a
       larger regular expression, that function	independently of the larger
       regular expression.  That is, they consume as much or as	little of the
       string as they wish without regard for the ability of the larger	regexp
       to match.  Independent subexpressions are represented by	"(?>regexp)".
       We can illustrate their behavior	by first considering an	ordinary
       regexp:

	   $x =	"ab";
	   $x =~ /a*ab/;  # matches

       This obviously matches, but in the process of matching, the
       subexpression "a*" first	grabbed	the 'a'.  Doing	so, however, wouldn't
       allow the whole regexp to match,	so after backtracking, "a*" eventually
       gave back the 'a' and matched the empty string.	Here, what "a*"
       matched was dependent on	what the rest of the regexp matched.

       Contrast	that with an independent subexpression:

	   $x =~ /(?>a*)ab/;  #	doesn't	match!

       The independent subexpression "(?>a*)" doesn't care about the rest of
       the regexp, so it sees an 'a' and grabs it.  Then the rest of the
       regexp "ab" cannot match.  Because "(?>a*)" is independent, there is no
       backtracking and	the independent	subexpression does not give up its
       'a'.  Thus the match of the regexp as a whole fails.  A similar
       behavior	occurs with completely independent regexps:

	   $x =	"ab";
	   $x =~ /a*/g;	  # matches, eats an 'a'
	   $x =~ /\Gab/g; # doesn't match, no 'a' available

       Here "/g" and "\G" create a "tag	team" handoff of the string from one
       regexp to the other.  Regexps with an independent subexpression are
       much like this, with a handoff of the string to the independent
       subexpression, and a handoff of the string back to the enclosing
       regexp.

       The ability of an independent subexpression to prevent backtracking can
       be quite	useful.	 Suppose we want to match a non-empty string enclosed
       in parentheses up to two	levels deep.  Then the following regexp
       matches:

	   $x =	"abc(de(fg)h";	# unbalanced parentheses
	   $x =~ /\( ( [ ^ () ]+ | \( [	^ () ]*	\) )+ \)/xx;

       The regexp matches an open parenthesis, one or more copies of an
       alternation, and	a close	parenthesis.  The alternation is two-way, with
       the first alternative "[^()]+" matching a substring with	no parentheses
       and the second alternative "\([^()]*\)"	matching a substring delimited
       by parentheses.	The problem with this regexp is	that it	is
       pathological: it	has nested indeterminate quantifiers of	the form
       "(a+|b)+".  We discussed	in Part	1 how nested quantifiers like this
       could take an exponentially long	time to	execute	if there was no	match
       possible.  To prevent the exponential blowup, we	need to	prevent
       useless backtracking at some point.  This can be	done by	enclosing the
       inner quantifier	as an independent subexpression:

	   $x =~ /\( ( (?> [ ^ () ]+ ) | \([ ^ () ]* \)	)+ \)/xx;

       Here, "(?>[^()]+)" breaks the degeneracy	of string partitioning by
       gobbling	up as much of the string as possible and keeping it.   Then
       match failures fail much	more quickly.

   Conditional expressions
       A conditional expression	is a form of if-then-else statement that
       allows one to choose which patterns are to be matched, based on some
       condition.  There are two types of conditional expression:
       "(?(condition)yes-regexp)" and "(?(condition)yes-regexp|no-regexp)".
       "(?(condition)yes-regexp)" is like an 'if () {}'	statement in Perl.  If
       the condition is	true, the yes-regexp will be matched.  If the
       condition is false, the yes-regexp will be skipped and Perl will	move
       onto the	next regexp element.  The second form is like an
       'if () {} else {}' statement in Perl.  If the condition is true,	the
       yes-regexp will be matched, otherwise the no-regexp will	be matched.

       The condition can have several forms.  The first	form is	simply an
       integer in parentheses "(integer)".  It is true if the corresponding
       backreference "\integer"	matched	earlier	in the regexp.	The same thing
       can be done with	a name associated with a capture group,	written	as
       "(<name_)" or "('name')".  The second form is a bare zero-width
       assertion "(?...)", either a lookahead, a lookbehind, or	a code
       assertion (discussed in the next	section).  The third set of forms
       provides	tests that return true if the expression is executed within a
       recursion ("(R)") or is being called from some capturing	group,
       referenced either by number ("(R1)", "(R2)",...)	or by name
       ("(R&name)").

       The integer or name form	of the "condition" allows us to	choose,	with
       more flexibility, what to match based on	what matched earlier in	the
       regexp. This searches for words of the form "$x$x" or "$x$y$y$x":

	   % simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
	   beriberi
	   coco
	   couscous
	   deed
	   ...
	   toot
	   toto
	   tutu

       The lookbehind "condition" allows, along	with backreferences, an
       earlier part of the match to influence a	later part of the match.  For
       instance,

	   /[ATGC]+(?(?<=AA)G|C)$/;

       matches a DNA sequence such that	it either ends in "AAG", or some other
       base pair combination and 'C'.  Note that the form is "(?(?<=AA)G|C)"
       and not "(?((?<=AA))G|C)"; for the lookahead, lookbehind	or code
       assertions, the parentheses around the conditional are not needed.

   Defining named patterns
       Some regular expressions	use identical subpatterns in several places.
       Starting	with Perl 5.10,	it is possible to define named subpatterns in
       a section of the	pattern	so that	they can be called up by name anywhere
       in the pattern.	This syntactic pattern for this	definition group is
       "(?(DEFINE)(?<name_pattern)...)".  An insertion of a named pattern is
       written as "(?&name)".

       The example below illustrates this feature using	the pattern for
       floating	point numbers that was presented earlier on.  The three
       subpatterns that	are used more than once	are the	optional sign, the
       digit sequence for an integer and the decimal fraction.	The "DEFINE"
       group at	the end	of the pattern contains	their definition.  Notice that
       the decimal fraction pattern is the first place where we	can reuse the
       integer pattern.

	  /^ (?&osg)\ *	( (?&int)(?&dec)? | (?&dec) )
	     (?: [eE](?&osg)(?&int) )?
	   $
	   (?(DEFINE)
	     (?<osg>[-+]?)	   # optional sign
	     (?<int>\d++)	   # integer
	     (?<dec>\.(?&int))	   # decimal fraction
	   )/x

   Recursive patterns
       This feature (introduced	in Perl	5.10) significantly extends the	power
       of Perl's pattern matching.  By referring to some other capture group
       anywhere	in the pattern with the	construct "(?group-ref)", the pattern
       within the referenced group is used as an independent subpattern	in
       place of	the group reference itself.  Because the group reference may
       be contained within the group it	refers to, it is now possible to apply
       pattern matching	to tasks that hitherto required	a recursive parser.

       To illustrate this feature, we'll design	a pattern that matches if a
       string contains a palindrome. (This is a	word or	a sentence that, while
       ignoring	spaces,	interpunctuation and case, reads the same backwards as
       forwards. We begin by observing that the	empty string or	a string
       containing just one word	character is a palindrome. Otherwise it	must
       have a word character up	front and the same at its end, with another
       palindrome in between.

	   /(?:	(\w) (?...Here be a palindrome...) \g{-1} | \w?	)/x

       Adding "\W*" at either end to eliminate what is to be ignored, we
       already have the	full pattern:

	   my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w?	) \W*)$/ix;
	   for $s ( "saippuakauppias", "A man, a plan, a canal:	Panama!" ){
	       print "'$s' is a	palindrome\n" if $s =~ /$pp/;
	   }

       In "(?...)" both	absolute and relative backreferences may be used.  The
       entire pattern can be reinserted	with "(?R)" or "(?0)".	If you prefer
       to name your groups, you	can use	"(?&name)" to recurse into that	group.

   A bit of magic: executing Perl code in a regular expression
       Normally, regexps are a part of Perl expressions.  Code evaluation
       expressions turn	that around by allowing	arbitrary Perl code to be a
       part of a regexp.  A code evaluation expression is denoted "(?{code})",
       with code a string of Perl statements.

       Code expressions	are zero-width assertions, and the value they return
       depends on their	environment.  There are	two possibilities: either the
       code expression is used as a conditional	in a conditional expression
       "(?(condition)...)", or it is not.  If the code expression is a
       conditional, the	code is	evaluated and the result (i.e.,	the result of
       the last	statement) is used to determine	truth or falsehood.  If	the
       code expression is not used as a	conditional, the assertion always
       evaluates true and the result is	put into the special variable $^R.
       The variable $^R	can then be used in code expressions later in the
       regexp.	Here are some silly examples:

	   $x =	"abcdef";
	   $x =~ /abc(?{print "Hi Mom!";})def/;	# matches,
						# prints 'Hi Mom!'
	   $x =~ /aaa(?{print "Hi Mom!";})def/;	# doesn't match,
						# no 'Hi Mom!'

       Pay careful attention to	the next example:

	   $x =~ /abc(?{print "Hi Mom!";})ddd/;	# doesn't match,
						# no 'Hi Mom!'
						# but why not?

       At first	glance,	you'd think that it shouldn't print, because obviously
       the "ddd" isn't going to	match the target string. But look at this
       example:

	   $x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
						   # but _does_	print

       Hmm. What happened here?	If you've been following along,	you know that
       the above pattern should	be effectively (almost)	the same as the	last
       one; enclosing the 'd' in a character class isn't going to change what
       it matches. So why does the first not print while the second one	does?

       The answer lies in the optimizations the	regexp engine makes. In	the
       first case, all the engine sees are plain old characters	(aside from
       the "?{}" construct). It's smart	enough to realize that the string
       'ddd' doesn't occur in our target string	before actually	running	the
       pattern through.	But in the second case,	we've tricked it into thinking
       that our	pattern	is more	complicated. It	takes a	look, sees our
       character class,	and decides that it will have to actually run the
       pattern to determine whether or not it matches, and in the process of
       running it hits the print statement before it discovers that we don't
       have a match.

       To take a closer	look at	how the	engine does optimizations, see the
       section "Pragmas	and debugging" below.

       More fun	with "?{}":

	   $x =~ /(?{print "Hi Mom!";})/;	# matches,
						# prints 'Hi Mom!'
	   $x =~ /(?{$c	= 1;})(?{print "$c";})/;  # matches,
						  # prints '1'
	   $x =~ /(?{$c	= 1;})(?{print "$^R";})/; # matches,
						  # prints '1'

       The bit of magic	mentioned in the section title occurs when the regexp
       backtracks in the process of searching for a match.  If the regexp
       backtracks over a code expression and if	the variables used within are
       localized using "local",	the changes in the variables produced by the
       code expression are undone! Thus, if we wanted to count how many	times
       a character got matched inside a	group, we could	use, e.g.,

	   $x =	"aaaa";
	   $count = 0;	# initialize 'a' count
	   $c =	"bob";	# test if $c gets clobbered
	   $x =~ /(?{local $c =	0;})	     # initialize count
		  ( a			     # match 'a'
		    (?{local $c	= $c + 1;})  # increment count
		  )*			     # do this any number of times,
		  aa			     # but match 'aa' at the end
		  (?{$count = $c;})	     # copy local $c var into $count
		 /x;
	   print "'a' count is $count, \$c variable is '$c'\n";

       This prints

	   'a' count is	2, $c variable is 'bob'

       If we replace the " (?{local $c = $c + 1;})" with " (?{$c = $c +	1;})",
       the variable changes are	not undone during backtracking,	and we get

	   'a' count is	4, $c variable is 'bob'

       Note that only localized	variable changes are undone.  Other side
       effects of code expression execution are	permanent.  Thus

	   $x =	"aaaa";
	   $x =~ /(a(?{print "Yow\n";}))*aa/;

       produces

	  Yow
	  Yow
	  Yow
	  Yow

       The result $^R is automatically localized, so that it will behave
       properly	in the presence	of backtracking.

       This example uses a code	expression in a	conditional to match a
       definite	article, either	'the' in English or 'der|die|das' in German:

	   $lang = 'DE';  # use	German
	   ...
	   $text = "das";
	   print "matched\n"
	       if $text	=~ /(?(?{
				 $lang eq 'EN';	# is the language English?
				})
			      the |		# if so, then match 'the'
			      (der|die|das)	# else,	match 'der|die|das'
			    )
			   /xi;

       Note that the syntax here is "(?(?{...})yes-regexp|no-regexp)", not
       "(?((?{...}))yes-regexp|no-regexp)".  In	other words, in	the case of a
       code expression,	we don't need the extra	parentheses around the
       conditional.

       If you try to use code expressions where	the code text is contained
       within an interpolated variable,	rather than appearing literally	in the
       pattern,	Perl may surprise you:

	   $bar	= 5;
	   $pat	= '(?{ 1 })';
	   /foo(?{ $bar	})bar/;	# compiles ok, $bar not	interpolated
	   /foo(?{ 1 })$bar/;	# compiles ok, $bar interpolated
	   /foo${pat}bar/;	# compile error!

	   $pat	= qr/(?{ $foo =	1 })/;	# precompile code regexp
	   /foo${pat}bar/;	# compiles ok

       If a regexp has a variable that interpolates a code expression, Perl
       treats the regexp as an error. If the code expression is	precompiled
       into a variable,	however, interpolating is ok. The question is, why is
       this an error?

       The reason is that variable interpolation and code expressions together
       pose a security risk.  The combination is dangerous because many
       programmers who write search engines often take user input and plug it
       directly	into a regexp:

	   $regexp = <>;       # read user-supplied regexp
	   $chomp $regexp;     # get rid of possible newline
	   $text =~ /$regexp/; # search	$text for the $regexp

       If the $regexp variable contains	a code expression, the user could then
       execute arbitrary Perl code.  For instance, some	joker could search for
       "system('rm -rf *');" to	erase your files.  In this sense, the
       combination of interpolation and	code expressions taints	your regexp.
       So by default, using both interpolation and code	expressions in the
       same regexp is not allowed.  If you're not concerned about malicious
       users, it is possible to	bypass this security check by invoking
       "use re 'eval'":

	   use re 'eval';	# throw	caution	out the	door
	   $bar	= 5;
	   $pat	= '(?{ 1 })';
	   /foo${pat}bar/;	# compiles ok

       Another form of code expression is the pattern code expression.	The
       pattern code expression is like a regular code expression, except that
       the result of the code evaluation is treated as a regular expression
       and matched immediately.	 A simple example is

	   $length = 5;
	   $char = 'a';
	   $x =	'aaaaabb';
	   $x =~ /(??{$char x $length})/x; # matches, there are	5 of 'a'

       This final example contains both	ordinary and pattern code expressions.
       It detects whether a binary string 1101010010001... has a Fibonacci
       spacing 0,1,1,2,3,5,...	of the '1''s:

	   $x =	"1101010010001000001";
	   $z0 = ''; $z1 = '0';	  # initial conditions
	   print "It is	a Fibonacci sequence\n"
	       if $x =~	/^1	    # match an initial '1'
			   (?:
			      ((??{ $z0	})) # match some '0'
			      1		    # and then a '1'
			      (?{ $z0 =	$z1; $z1 .= $^N; })
			   )+	# repeat as needed
			 $	# that is all there is
			/x;
	   printf "Largest sequence matched was	%d\n", length($z1)-length($z0);

       Remember	that $^N is set	to whatever was	matched	by the last completed
       capture group. This prints

	   It is a Fibonacci sequence
	   Largest sequence matched was	5

       Ha! Try that with your garden variety regexp package...

       Note that the variables $z0 and $z1 are not substituted when the	regexp
       is compiled, as happens for ordinary variables outside a	code
       expression.  Rather, the	whole code block is parsed as perl code	at the
       same time as perl is compiling the code containing the literal regexp
       pattern.

       This regexp without the "/x" modifier is

	   /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/

       which shows that	spaces are still possible in the code parts.
       Nevertheless, when working with code and	conditional expressions, the
       extended	form of	regexps	is almost necessary in creating	and debugging
       regexps.

   Backtracking	control	verbs
       Perl 5.10 introduced a number of	control	verbs intended to provide
       detailed	control	over the backtracking process, by directly influencing
       the regexp engine and by	providing monitoring techniques.  See "Special
       Backtracking Control Verbs" in perlre for a detailed description.

       Below is	just one example, illustrating the control verb	"(*FAIL)",
       which may be abbreviated	as "(*F)". If this is inserted in a regexp it
       will cause it to	fail, just as it would at some mismatch	between	the
       pattern and the string. Processing of the regexp	continues as it	would
       after any "normal" failure, so that, for	instance, the next position in
       the string or another alternative will be tried.	As failing to match
       doesn't preserve	capture	groups or produce results, it may be necessary
       to use this in combination with embedded	code.

	  %count = ();
	  "supercalifragilisticexpialidocious" =~
	      /([aeiou])(?{ $count{$1}++; })(*FAIL)/i;
	  printf "%3d '%s'\n", $count{$_}, $_ for (sort	keys %count);

       The pattern begins with a class matching	a subset of letters.  Whenever
       this matches, a statement like "$count{'a'}++;" is executed,
       incrementing the	letter's counter. Then "(*FAIL)" does what it says,
       and the regexp engine proceeds according	to the book: as	long as	the
       end of the string hasn't	been reached, the position is advanced before
       looking for another vowel. Thus,	match or no match makes	no difference,
       and the regexp engine proceeds until the	entire string has been
       inspected.  (It's remarkable that an alternative	solution using
       something like

	  $count{lc($_)}++ for split('', "supercalifragilisticexpialidocious");
	  printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );

       is considerably slower.)

   Pragmas and debugging
       Speaking	of debugging, there are	several	pragmas	available to control
       and debug regexps in Perl.  We have already encountered one pragma in
       the previous section, "use re 'eval';", that allows variable
       interpolation and code expressions to coexist in	a regexp.  The other
       pragmas are

	   use re 'taint';
	   $tainted = <>;
	   @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted

       The "taint" pragma causes any substrings	from a match with a tainted
       variable	to be tainted as well.	This is	not normally the case, as
       regexps are often used to extract the safe bits from a tainted
       variable.  Use "taint" when you are not extracting safe bits, but are
       performing some other processing.  Both "taint" and "eval" pragmas are
       lexically scoped, which means they are in effect	only until the end of
       the block enclosing the pragmas.

	   use re '/m';	 # or any other	flags
	   $multiline_string =~	/^foo/;	# /m is	implied

       The "re '/flags'" pragma	(introduced in Perl 5.14) turns	on the given
       regular expression flags	until the end of the lexical scope.  See
       "'/flags' mode" in re for more detail.

	   use re 'debug';
	   /^(.*)$/s;	    # output debugging info

	   use re 'debugcolor';
	   /^(.*)$/s;	    # output debugging info in living color

       The global "debug" and "debugcolor" pragmas allow one to	get detailed
       debugging info about regexp compilation and execution.  "debugcolor" is
       the same	as debug, except the debugging information is displayed	in
       color on	terminals that can display termcap color sequences.  Here is
       example output:

	   % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
	   Compiling REx 'a*b+c'
	   size	9 first	at 1
	      1: STAR(4)
	      2:   EXACT <a>(0)
	      4: PLUS(7)
	      5:   EXACT <b>(0)
	      7: EXACT <c>(9)
	      9: END(0)
	   floating 'bc' at 0..2147483647 (checking floating) minlen 2
	   Guessing start of match, REx	'a*b+c'	against	'abc'...
	   Found floating substr 'bc' at offset	1...
	   Guessed: match at offset 0
	   Matching REx	'a*b+c'	against	'abc'
	     Setting an	EVAL scope, savestack=3
	      0	<> <abc>	   |  1:  STAR
				    EXACT <a> can match	1 times	out of 32767...
	     Setting an	EVAL scope, savestack=3
	      1	<a> <bc>	   |  4:    PLUS
				    EXACT <b> can match	1 times	out of 32767...
	     Setting an	EVAL scope, savestack=3
	      2	<ab> <c>	   |  7:      EXACT <c>
	      3	<abc> <>	   |  9:      END
	   Match successful!
	   Freeing REx:	'a*b+c'

       If you have gotten this far into	the tutorial, you can probably guess
       what the	different parts	of the debugging output	tell you.  The first
       part

	   Compiling REx 'a*b+c'
	   size	9 first	at 1
	      1: STAR(4)
	      2:   EXACT <a>(0)
	      4: PLUS(7)
	      5:   EXACT <b>(0)
	      7: EXACT <c>(9)
	      9: END(0)

       describes the compilation stage.	 STAR(4) means that there is a starred
       object, in this case 'a', and if	it matches, goto line 4, i.e.,
       PLUS(7).	 The middle lines describe some	heuristics and optimizations
       performed before	a match:

	   floating 'bc' at 0..2147483647 (checking floating) minlen 2
	   Guessing start of match, REx	'a*b+c'	against	'abc'...
	   Found floating substr 'bc' at offset	1...
	   Guessed: match at offset 0

       Then the	match is executed and the remaining lines describe the
       process:

	   Matching REx	'a*b+c'	against	'abc'
	     Setting an	EVAL scope, savestack=3
	      0	<> <abc>	   |  1:  STAR
				    EXACT <a> can match	1 times	out of 32767...
	     Setting an	EVAL scope, savestack=3
	      1	<a> <bc>	   |  4:    PLUS
				    EXACT <b> can match	1 times	out of 32767...
	     Setting an	EVAL scope, savestack=3
	      2	<ab> <c>	   |  7:      EXACT <c>
	      3	<abc> <>	   |  9:      END
	   Match successful!
	   Freeing REx:	'a*b+c'

       Each step is of the form	"n <x> <y>", with "<x>"	the part of the	string
       matched and "<y>" the part not yet matched.  The	"|  1:	STAR" says
       that Perl is at line number 1 in	the compilation	list above.  See
       "Debugging Regular Expressions" in perldebguts for much more detail.

       An alternative method of	debugging regexps is to	embed "print"
       statements within the regexp.  This provides a blow-by-blow account of
       the backtracking	in an alternation:

	   "that this" =~ m@(?{print "Start at position	", pos,	"\n";})
			    t(?{print "t1\n";})
			    h(?{print "h1\n";})
			    i(?{print "i1\n";})
			    s(?{print "s1\n";})
				|
			    t(?{print "t2\n";})
			    h(?{print "h2\n";})
			    a(?{print "a2\n";})
			    t(?{print "t2\n";})
			    (?{print "Done at position ", pos, "\n";})
			   @x;

       prints

	   Start at position 0
	   t1
	   h1
	   t2
	   h2
	   a2
	   t2
	   Done	at position 4

SEE ALSO
       This is just a tutorial.	 For the full story on Perl regular
       expressions, see	the perlre regular expressions reference page.

       For more	information on the matching "m//" and substitution "s///"
       operators, see "Regexp Quote-Like Operators" in perlop.	For
       information on the "split" operation, see "split" in perlfunc.

       For an excellent	all-around resource on the care	and feeding of regular
       expressions, see	the book Mastering Regular Expressions by Jeffrey
       Friedl (published by O'Reilly, ISBN 1556592-257-3).

AUTHOR AND COPYRIGHT
       Copyright (c) 2000 Mark Kvale.  All rights reserved.  Now maintained by
       Perl porters.

       This document may be distributed	under the same terms as	Perl itself.

   Acknowledgments
       The inspiration for the stop codon DNA example came from	the ZIP	code
       example in chapter 7 of Mastering Regular Expressions.

       The author would	like to	thank Jeff Pinyan, Andrew Johnson, Peter
       Haworth,	Ronald J Kimball, and Joe Smith	for all	their helpful
       comments.

perl v5.26.0			  2017-04-19			  PERLRETUT(1)

NAME | DESCRIPTION | Part 1: The basics | Part 2: Power tools | SEE ALSO | AUTHOR AND COPYRIGHT

Want to link to this manual page? Use this URL:
<https://www.freebsd.org/cgi/man.cgi?query=perlretut&sektion=1&manpath=FreeBSD+12.0-RELEASE+and+Ports>

home | help