Skip site navigation (1)Skip section navigation (2)

FreeBSD Manual Pages

  
 
  

home | help
RNAUP(1)			 User Commands			      RNAUP(1)

NAME
       RNAup - manual page for RNAup 2.4.14

SYNOPSIS
       RNAup [OPTIONS]...

DESCRIPTION
       RNAup 2.4.14

       Calculate the thermodynamics of RNA-RNA interactions

       RNAup  calculates the thermodynamics of RNA-RNA interactions, by	decom-
       posing the binding into two stages. (1) First the  probability  that  a
       potential binding sites remains unpaired	(equivalent to the free	energy
       needed to open the site)	is computed. (2) Then  this  accessibility  is
       combined	 with  the  interaction	energy to obtain the total binding en-
       ergy. All calculations are done by computing partition  functions  over
       all possible conformations.

       RNAup  provides two different modes: By default RNAup computes accessi-
       bilities, in terms of the free energies needed to open  a  region  (de-
       fault  length 4). It prints the region of highest accessibility and its
       opening energy to stdout, opening energies for all  other  regions  are
       written to a file.

       In  interaction mode the	interaction between two	RNAs is	calculated. It
       is invoked if the input consists	of two sequences concatenated with  an
       "&",  or	if the options -X[pf] or -b are	given. Unless the -b option is
       specified RNAup assumes that the	longer RNA is a	structured target  se-
       quence while the	shorter	one is an unstructured small RNA.
       Additionally, for every position	along the target sequence we write the
       best free energy	of binding for an interaction that includes this posi-
       tion to the the output file.  Output to stdout consists of the location
       and free	energy,	dG, for	the optimal region of interaction. The binding
       energy  dG  is  also  split  into its components	the interaction	energy
       dGint and the opening energy dGu_l (and possibly	dGu_s for the  shorter
       sequence).
       In  addition  we	print the optimal interaction structure	as computed by
       RNAduplex for this region. Note that it can happen that	the  RNAduplex
       computed	 optimal  interaction does not coincide	with the optimal RNAup
       region. If the two predictions don't match the structure	string is  re-
       placed by a run of "."  and a message is	written	to stderr.

       Each  sequence should be	in 5' to 3' direction. If the sequence is pre-
       ceded by	a line of the form
       > name

       the output file "name_ux_up.out"	is produced, where the "x" in "ux"  is
       the  value  set	by  the	-u option. Otherwise the file name defaults to
       RNA_ux_up.out. The output is concatenated if a file with	the same  name
       exists.

       RNA sequences are read from stdin as strings of characters. White space
       and newline within a sequence cause an error! Newline is	used to	 sepa-
       rate sequences. The program will	continue to read new sequences until a
       line consisting of the single character @ or an end of  file  condition
       is encountered.

       -h, --help
	      Print help and exit

       --detailed-help
	      Print help, including all	details	and hidden options, and	exit

       --full-help
	      Print help, including hidden options, and	exit

       -V, --version
	      Print version and	exit

   General Options:
	      Below  are command line options which alter the general behavior
	      of this program

       -C, --constraint
	      Calculate	structures subject to constraints.  (default=off)

	      The program reads	first the sequence(s), then a string  contain-
	      ing constraints on the structure encoded with the	symbols:

	      .	(no constraint for this	base)

	      x	 (the  base  is	unpaired) < (base i is paired with a base j>i)
	      (solely used for calculation of

	      unpaired regions)

	      >	(base i	is paired with a base j<i) (solely used	 for  calcula-
	      tion of

	      unpaired regions)

	      (	 )  (base  i pairs base	j) | (the corresponding	base has to be
	      paired intermolecularily (works only in

	      interaction mode)

       -o, --no_output_file
	      Do not produce an	output file

	      (default=off)

       --no_header
	      Do not produce a header with the command line parameters used in
	      the outputfile

	      (default=off)

       --noconv
	      Do not automatically substitude nucleotide "T" with "U"

	      (default=off)

   Calculations	of opening energies:
       -u, --ulength=length
	      specifies	the length of the unstructured region in the output.

	      (default=`4')

	      The probability of being unpaired	is plotted on the right	border
	      of the unpaired region. You  can	specify	 up  to	 20  different
	      length  values:  use "-" to specify a range of continuous	values
	      (e.g. -u 4-8) or specify a list of comma separated values	 (e.g.
	      -u 4,8,15).

       -c, --contributions=SHIME
	      Specify the contributions	listed in the output (default=`S')

	      By  default only the full	probability of being unpaired is plot-
	      ted. The -c option allows	one to get the different contributions
	      (c)  to  the probability of being	unpaired: The full probability
	      of being unpaired	("S" is	the sum	of the	probability  of	 being
	      unpaired	in  the	 exterior  loop	 ("E"),	 within	a hairpin loop
	      ("H"), within an interior	loop  ("I")  and  within  a  multiloop
	      ("M"). Any combination of	these letters may be given.

   Calculations	of RNA-RNA interactions:
       -w, --window=INT
	      Determine	the maximal length of the region of interaction

	      (default=`25')

       -b, --include_both
	      Include the probability of unpaired regions in both (b) RNAs. By
	      default only the probability of being unpaired in	the longer RNA
	      (target) is used.

	      (default=off)

       -5, --extend5=INT
	      Extend  the region of interaction	in the target to some residues
	      on the 5'	side

	      The underlying assumption	is that	it is favorable	for an	inter-
	      action  if not only the direct region of contact is unpaired but
	      also a few residues 5'

       -3, --extend3=INT
	      Extend the region	of interaction in the target to	some  residues
	      on the 3'	side

	      The  underlying assumption is that it is favorable for an	inter-
	      action if	not only the direct region of contact is unpaired  but
	      also a few residues 3'

       --interaction_pairwise
	      Activate pairwise	interaction mode (default=off)

	      The  first  sequence  interacts with the 2nd, the	third with the
	      4th etc. If activated, two interacting sequences may be given in
	      a	 single	line separated by "&" or each sequence may be given on
	      an extra line.

       --interaction_first
	      Activate interaction mode	using first sequence only

	      (default=off)

	      The interaction of each sequence with the	first  one  is	calcu-
	      lated (e.g.  interaction of one mRNA with	many small RNAs). Each
	      sequence has to be given on an extra line

   Model Details:
       -S, --pfScale=DOUBLE
	      In the calculation of the	pf use scale*mfe as  an	 estimate  for
	      the  ensemble free energy	(used to avoid overflows). The default
	      is 1.07, useful values are 1.0 to	1.2. Occasionally  needed  for
	      long  sequences.	You can	also recompile the program to use dou-
	      ble precision (see the README file).

       -T, --temp=DOUBLE
	      Rescale energy parameters	to a temperature of temp C. Default is
	      37C.

       -4, --noTetra
	      Do  not include special tabulated	stabilizing energies for tri-,
	      tetra- and hexaloop hairpins. Mostly for testing.

	      (default=off)

       -d, --dangles=INT
	      How to treat "dangling end" energies for bases adjacent  to  he-
	      lices in free ends and multi-loops

	      (default=`2')

	      With  -d2	dangling energies will be added	for the	bases adjacent
	      to a helix on both sides in any case.

	      The option -d0 ignores dangling ends altogether (mostly for  de-
	      bugging).

       --noLP Produce structures without lonely	pairs (helices of length 1).

	      (default=off)

	      For  partition  function	folding	this only disallows pairs that
	      can only occur isolated. Other pairs may still occasionally  oc-
	      cur as helices of	length 1.

       --noGU Do not allow GU pairs

	      (default=off)

       --noClosingGU
	      Do not allow GU pairs at the end of helices

	      (default=off)

       -P, --paramFile=paramfile
	      Read  energy parameters from paramfile, instead of using the de-
	      fault parameter set.

	      Different	sets of	energy parameters for RNA and DNA  should  ac-
	      company your distribution.  See the RNAlib documentation for de-
	      tails on the file	format.	When passing the placeholder file name
	      "DNA",  DNA  parameters  are loaded without the need to actually
	      specify any input	file.

       --nsp=STRING
	      Allow other pairs	in addition to the usual AU,GC,and GU pairs.

	      Its argument is a	comma separated	list of	 additionally  allowed
	      pairs.  If  the first character is a "-" then AB will imply that
	      AB and BA	are allowed pairs.  e.g. RNAfold -nsp -GA  will	 allow
	      GA and AG	pairs. Nonstandard pairs are given 0 stacking energy.

       -e, --energyModel=INT
	      Rarely used option to fold sequences from	the artificial ABCD...
	      alphabet,	where A	pairs B, C-D etc.  Use the  energy  parameters
	      for GC (-e 1) or AU (-e 2) pairs.

REFERENCES
       If you use this program in your work you	might want to cite:

       R.  Lorenz,  S.H.  Bernhart,  C.	 Hoener	 zu Siederdissen, H. Tafer, C.
       Flamm, P.F. Stadler and I.L. Hofacker (2011), "ViennaRNA	Package	 2.0",
       Algorithms for Molecular	Biology: 6:26

       I.L.  Hofacker,	W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P.
       Schuster	(1994),	"Fast Folding and Comparison of	RNA  Secondary	Struc-
       tures", Monatshefte f. Chemie: 125, pp 167-188

       R.  Lorenz,  I.L. Hofacker, P.F.	Stadler	(2016),	"RNA folding with hard
       and soft	constraints", Algorithms for Molecular Biology 11:1 pp 1-13

       U. Mueckstein, H. Tafer,	J. Hackermueller, S.H. Bernhart, P.F. Stadler,
       and  I.L.  Hofacker (2006), "Thermodynamics of RNA-RNA Binding",	Bioin-
       formatics: 22(10), pp 1177-1182

       The energy parameters are taken from:

       D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J.	Schroeder,  J.
       Susan,  M. Zuker, D.H. Turner (2004), "Incorporating chemical modifica-
       tion constraints	into a dynamic programming algorithm for prediction of
       RNA secondary structure", Proc. Natl. Acad. Sci.	USA: 101, pp 7287-7292

       D.H  Turner, D.H. Mathews (2009), "NNDB:	The nearest neighbor parameter
       database	for predicting stability of nucleic acid secondary structure",
       Nucleic Acids Research: 38, pp 280-282

EXAMPLES
       Output to stdout:

       In  Interaction mode RNAup prints the most favorable interaction	energy
       between the two sequences to stdout. The	most favorable interaction en-
       ergy (dG) depends on the	position in the	longer sequence	(region	[i,j])
       and the position	in the shorter	sequence  (region[k,l]):  dG[i,j;k,l].
       dG[i,j;k,l] is the largest contribution to dG[i,j] = sum_kl dG[i,j;k,l]
       which is	given in the output file: therefore dG[i,j;k,l]	<= dG[i,j].

	 '....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8'
	 > franz
	 GGAGUAGGUUAUCCUCUGUU
	 > sissi
	 AGGACAACCU
	 dG = dGint + dGu_l
	 (((((.((((&)))).)))))	 6,15  :   1,10	 (-6.66	= -9.89	+ 3.23)
	 AGGUUAUCCU&AGGACAACCU
	 RNAup output in file: franz_sissi_w25_u3_4_up.out

       where the result	line contains following	information

	 RNAduplex results	 [i,j]	   [k,l]    dG = dGint + dGu_l
	 (((((.((((&)))).)))))	 6,15	:  1,10	    (-6.66=-9.89+3.23)

       Output to file:

       Output to file contains a header	including date,	the  command  line  of
       the  call  to RNAup, length and names of	the input sequence(s) followed
       by the sequence(s). The first sequence is the target sequence.	Print-
       ing of the header can be	turned off using the -nh option.

       The  line directly after	the header gives the column names for the out-
       put:

	 position     dGu_l for	-u 3	  dGu_l	for -u 4       dG
       #     pos      u3S	u3H	  u4S	    u4H	       dG

       where all information refers to the target sequence. The	 dGu_l	column
       contains	 information about the -u value	(u=3 or	u=4) and the contribu-
       tion to the free	energy to open all  structures	"S"  or	 only  hairpin
       loops  "H",  see	option -c.  NA means that no results is	possible (e.g.
       column u3S row 2: no region of length 3 ending at position 2 exists).

       #  Thu Apr 10 09:15:11 2008
       #  RNAup	-u 3,4 -c SH -b
       #  20 franz
       #  GGAGUAGGUUAUCCUCUGUU
       #  10 sissi
       #  AGGACAACCU
       #     pos      u3S	u3H	  u4S	    u4H	       dG
	      1	       NA	 NA	   NA	     NA	   -1.540
	      2	       NA	 NA	   NA	     NA	   -1.540
	      3	    1.371	 NA	   NA	     NA	   -1.217
	      4	    1.754     5.777	1.761	     NA	   -1.393
	      5	    1.664     3.140	1.811	  5.800	   -1.393

       If the -b option	is selected position and dGu_s values for the  shorter
       sequence	are written after the information for the target sequence.

AUTHOR
       Ivo L Hofacker, Peter F Stadler,	Ulrike Mueckstein, Ronny Lorenz

REPORTING BUGS
       If  in doubt our	program	is right, nature is at fault.  Comments	should
       be sent to rna@tbi.univie.ac.at.

RNAup 2.4.14			  August 2019			      RNAUP(1)

NAME | SYNOPSIS | DESCRIPTION | REFERENCES | EXAMPLES | AUTHOR | REPORTING BUGS

Want to link to this manual page? Use this URL:
<https://www.freebsd.org/cgi/man.cgi?query=RNAup&sektion=1&manpath=FreeBSD+12.2-RELEASE+and+Ports>

home | help