Skip site navigation (1)Skip section navigation (2)

FreeBSD Manual Pages

  
 
  

home | help
RNAALIFOLD(1)			 User Commands			 RNAALIFOLD(1)

NAME
       RNAalifold - manual page	for RNAalifold 2.4.14

SYNOPSIS
       RNAalifold [options] [_input0.aln_] [_input1.aln_]...

DESCRIPTION
       RNAalifold 2.4.14

       calculate secondary structures for a set	of aligned RNAs

       Read  aligned  RNA sequences from stdin or file.aln and calculate their
       minimum free energy (mfe) structure, partition function (pf)  and  base
       pairing	probability  matrix. Currently,	input alignments have to be in
       CLUSTAL,	Stockholm, FASTA, or MAF format. The input format must be  set
       manually	 in  interactive mode (default is Clustal), but	will be	deter-
       mined automagically from	the input file,	if not expplicitly set.	It re-
       turns  the  mfe structure in bracket notation, its energy, the free en-
       ergy of the thermodynamic ensemble and the frequency of the mfe	struc-
       ture in the ensemble to stdout.	It also	produces Postscript files with
       plots of	the resulting secondary	structure graph	 ("alirna.ps")	and  a
       "dot  plot"  of	the base pairing matrix	("alidot.ps").	The file "ali-
       fold.out" will contain a	list of	likely pairs  sorted  by  credibility,
       suitable	for viewing  with "AliDot.pl". Be warned that output file will
       overwrite any existing files of the same	name.

       -h, --help
	      Print help and exit

       --detailed-help
	      Print help, including all	details	and hidden options, and	exit

       --full-help
	      Print help, including hidden options, and	exit

       -V, --version
	      Print version and	exit

   General Options:
	      Command line options which alter the general  behavior  of  this
	      program

       -v, --verbose
	      Be verbose.

	      (default=off)

       -q, --quiet
	      Be quiet.	 (default=off)

	      This option can be used to minimize the output of	additional in-
	      formation	and non-severe warnings	 which	otherwise  might  spam
	      stdout/stderr.

       -j, --jobs[=number]
	      Split batch input	into jobs and start processing in parallel us-
	      ing multiple threads. A value of 0 indicates to use as many par-
	      allel threads as computation cores are available.

	      (default=`0')

	      Default  processing of input data	is performed in	a serial fash-
	      ion, i.e.	one alignment at a time. Using this switch, a user can
	      instead  start  the computation for many alignments in the input
	      in parallel. RNAalifold will create as many parallel computation
	      slots  as	 specified  and	 assigns input alignments of the input
	      file(s) to the available slots. Note, that this increases	memory
	      consumption since	input alignments have to be kept in memory un-
	      til an empty compute slot	is available and each running job  re-
	      quires its own dynamic programming matrices.

       --unordered
	      Do  not  try  to	keep output in order with input	while parallel
	      processing is in place.

	      (default=off)

	      When parallel input processing (--jobs flag) is enabled, the or-
	      der in which input is processed depends on the host machines job
	      scheduler. Therefore, any	output to stdout or files generated by
	      this program will	most likely not	follow the order of the	corre-
	      sponding input data set. The default of RNAalifold is to	use  a
	      specialized  data	 structure to still keep the results output in
	      order with the input data. However, this comes with a  trade-off
	      in terms of memory consumption, since all	output must be kept in
	      memory for as long as no chunks of consecutive,  ordered	output
	      are  available. By setting this flag, RNAalifold will not	buffer
	      individual results but print them	as soon	as they	have been com-
	      putated.

       --noconv
	      Do not automatically substitute nucleotide "T" with "U"

	      (default=off)

       --color
	      Produce  a  colored  version  of	the  consensus	structure plot
	      "alirna.ps" (default b&w only)

	      (default=off)

       --aln  Produce a	colored	and structure  annotated  alignment  in	 Post-
	      Script format in the file	"aln.ps" in the	current	directory.

	      (default=off)

       --aln-EPS-cols=INT
	      Number of	columns	in colored EPS alignment output.

	      (default=`60')

	      A	 value	less  than  1  indicates that the output should	not be
	      wrapped at all.

       --aln-stk[=prefix]
	      Create  a	  multi-Stockholm   formatted	output	 file.	  (de-
	      fault=`RNAalifold_results')

	      The  default  file  name	used for the output is "RNAalifold_re-
	      sults.stk".  Users may change the	filename  to  "prefix.stk"  by
	      specifying  the  prefix  as  optional argument. The file will be
	      create in	the current directory if it does not already exist. In
	      case  the	 file  already	exists,	output will be appended	to it.
	      Note: Any	special	characters in the filename will	be replaced by
	      the  filename delimiter, hence there is no way to	pass an	entire
	      directory	path through this option yet. (See also	 the  "--file-
	      name-delim" parameter)

       -t, --layout-type=INT
	      Choose  the  layout  algorithm.  Simple  radial  layout if 0, or
	      naview if	1

	      (default=`1')

       --noPS Do not produce postscript	drawing	of the mfe structure.

	      (default=off)

       --noDP Do not produce dot-plot postscript file containing base pair  or
	      stack probabilitities.

	      (default=off)

	      In  combination with the -p option, this flag turns-off creation
	      of individual dot-plot files. Consequently, computed  base  pair
	      probability  output  is  omitted	but centroid and MEA structure
	      prediction is still performed.

       -f, --input-format=C|S|F|M
	      File format of the input multiple	sequence alignment (MSA).

	      If this parameter	is set,	the input is considered	 to  be	 in  a
	      particular  file	format.	Otherwise, the program tries to	deter-
	      mine the file format automatically, if an	input  file  was  pro-
	      vided  in	 the  set of parameters. In case the input MSA is pro-
	      vided in interactive mode, or from a terminal  (TTY),  the  pro-
	      grams default is to assume CLUSTALW format.  Currently, the fol-
	      lowing formats are available: ClustalW (C), Stockholm  1.0  (S),
	      FASTA/Pearson (F), and MAF (M).

       -n, --continuous-ids
	      Use  continuous  alignment ID numbering when no alignment	ID can
	      be retrieved from	input data.

	      (default=off)

	      Due to its past, RNAalifold produces a specific  set  of	output
	      file  names  for	the  first input alignment, "alirna.ps", "ali-
	      dot.ps", etc. But	for all	further	alignments in  the  input,  it
	      usually  adopts  a  naming scheme	based on IDs, which may	be re-
	      trieved from the input alignment's meta-data, or generated by  a
	      prefix  followed by an increasing	counter. Setting this flag in-
	      structs RNAalifold to use	the ID	naming	scheme	also  for  the
	      first alignment.

       --auto-id
	      Automatically generate an	ID for each alignment.

	      (default=off)

	      The  default mode	of RNAalifold is to automatically determine an
	      ID from the input	alignment if the input file format  allows  to
	      do  that.	 Alignment  IDs	 are,  for  instance, usually given in
	      Stockholm	1.0 formatted input. If	this flag is  active,  RNAali-
	      fold  ignores any	IDs retrieved from the input and automatically
	      generates	an ID for each alignment.

       --id-prefix=prefix
	      Prefix for automatically generated IDs (as used in  output  file
	      names)

	      (default=`alignment')

	      If  this	parameter is set, each alignment will be prefixed with
	      the provided string. Hence, the output files will	obey the  fol-
	      lowing  naming  scheme: "prefix_xxxx_ss.ps" (secondary structure
	      plot), "prefix_xxxx_dp.ps" (dot-plot), "prefix_xxxx_aln.ps" (an-
	      notated  alignment), etc.	where xxxx is the alignment number be-
	      ginning with the second alignment	in the input. Use this setting
	      in  conjunction with the --continuous-ids	flag to	assign IDs be-
	      ginning with the first input alignment.

       --id-delim=delimiter
	      Change the delimiter between prefix and  increasing  number  for
	      automatically generated IDs (as used in output file names)

	      (default=`_')

	      This  parameter  can be used to change the default delimiter "_"
	      between

	      the prefix string	and the	increasing  number  for	 automatically
	      generated	ID.

       --id-digits=INT
	      Specify  the  number  of	digits of the counter in automatically
	      generated	alignment IDs.

	      (default=`4')

	      When alignments IDs are automatically generated, they receive an
	      increasing  number,  starting with 1. This number	will always be
	      left-padded by leading zeros, such that the number  takes	 up  a
	      certain  width. Using this parameter, the	width can be specified
	      to the users need. We allow numbers in the range [1:18].

       --id-start=LONG
	      Specify the first	number in  automatically  generated  alignment
	      IDs.

	      (default=`1')

	      When  alignment IDs are automatically generated, they receive an
	      increasing number, usually starting with 1. Using	 this  parame-
	      ter,  the	 first	number	can be specified to the	users require-
	      ments. Note: negative numbers are	not  allowed.	Note:  Setting
	      this  parameter  implies continuous alignment IDs, i.e. it acti-
	      vates the	--continuous-ids flag.

       --filename-delim=delimiter
	      Change the delimiting character that is used

	      for sanitized filenames

	      (default=`ID-delimiter')

	      This parameter can be used to change  the	 delimiting  character
	      used  while sanitizing filenames,	i.e. replacing invalid charac-
	      ters. Note, that the default delimiter ALWAYS is the first char-
	      acter  of	 the "ID delimiter" as supplied	through	the --id-delim
	      option. If the delimiter is a whitespace character or empty, in-
	      valid characters will be simply removed rather than substituted.
	      Currently, we regard the following characters as illegal for use
	      in  filenames: backslash '\', slash '/', question	mark '?', per-
	      cent sign	'%', asterisk '*', colon ':', pipe symbol '|',	double
	      quote '"', triangular brackets '<' and '>'.

   Structure Constraints:
	      Command  line options to interact	with the structure constraints
	      feature of this program

       --maxBPspan=INT
	      Set the maximum base pair	span

	      (default=`-1')

       -C, --constraint[=<filename>]  Calculate	 structures  subject  to  con-
       straints.
	      The constraining structure will be read from 'stdin', the	align-
	      ment has to be given as a	file name on the command line.

	      (default=`')

	      The program reads	first the sequence, then a  string  containing
	      constraints on the structure encoded with	the symbols:

	      .	(no constraint for this	base)

	      |	(the corresponding base	has to be paired

	      x	(the base is unpaired)

	      <	(base i	is paired with a base j>i)

	      >	(base i	is paired with a base j<i)

	      and matching brackets ( )	(base i	pairs base j)

	      With  the	 exception of "|", constraints will disallow all pairs
	      conflicting with the constraint. This is usually	sufficient  to
	      enforce  the  constraint,	 but  occasionally a base may stay un-
	      paired in	spite of constraints. PF folding  ignores  constraints
	      of type "|".

       --batch
	      Use constraints for all alignment	records.  (default=off)

	      Usually,	constraints  provided from input file are only applied
	      to a single sequence alignment. Therefore, RNAalifold will  stop
	      its  computation	and  quit  after the first input alignment was
	      processed. Using this switch, RNAalifold processes all  sequence
	      alignments  in  the  input  and  applies	the same provided con-
	      straints to each of them.

       --enforceConstraint
	      Enforce base pairs given by round	brackets ( ) in	structure con-
	      straint

	      (default=off)

       --SS_cons
	      Use  consensus  structures from Stockholm	file (#=GF SS_cons) as
	      constraint

	      (default=off)

	      Stockholm	formatted alignment  files  have  the  possibility  to
	      store  a secondary structure string in one of if ("#=GC")	column
	      annotation meta tags. The	 corresponding	tag  name  is  usually
	      "SS_cons", a consensus secondary structure. Activating this flag
	      allows one to use	this consensus secondary  structure  from  the
	      input  file as structure constraint. Currently, only the follow-
	      ing characters are interpreted:

	      (	) [mathing parenthesis:	column i pairs with column j]

	      <	> [matching angular brackets: column i pairs with column j]

	      All other	characters are not interpreted (yet).  Note:  Activat-
	      ing this flag implies --constraint.

       --shape=file1,file2
	      Use SHAPE	reactivity data	to guide structure predictions

	      Multiple	shapefiles  for	the individual sequences in the	align-
	      ment may be specified  as	a comma	separated  list.  An  optional
	      association of particular	shape files to a specific  sequence in
	      the alignment can	be expressed by	prepending the sequence	number
	      to  the filename,	 e.g.  "5=seq5.shape,3=seq3.shape" will	assign
	      the reactivity values from file seq5.shape  to   the  fifth  se-
	      quence  in the alignment,	and the	values from file seq3.shape to
	      sequence 3. If  no assignment is specified, the reactivity  val-
	      ues  are	assigned to corresponding sequences in	the order they
	      are given.

       --shapeMethod=D[mX][bY]
	      Specify the method how  to  convert  SHAPE  reactivity  data  to
	      pseudo energy contributions

	      (default=`D')

	      Currently,  the only data	conversion method available is that of
	      to Deigan	et al 2009.  This method is the	default	and is	recog-
	      nized  by	 a  capital  'D'  in  the  provided  parameter,	 i.e.:
	      --shapeMethod="D"	is the default setting.	 The slope 'm' and the
	      intercept	 'b'  can be set to a  non-default value if necessary.
	      Otherwise	m=1.8 and b=-0.6 as stated in the paper	mentionen  be-
	      fore.   To  alter	these parameters, e.g. m=1.9 and b=-0.7, use a
	      parameter	string like this: --shapeMethod="Dm1.9b-0.7". You  may
	      also   provide   only   one   of	 the   two   parameters	 like:
	      --shapeMethod="Dm1.9" or --shapeMethod="Db-0.7".

   Algorithms:
	      Select additional	algorithms which should	 be  included  in  the
	      calculations.   The  Minimum  free  energy (MFE) and a structure
	      representative are calculated in any case.

       -p, --partfunc[=INT]
	      Calculate	the partition function and  base  pairing  probability
	      matrix  in addition to the mfe structure.	Default	is calculation
	      of mfe structure only.

	      (default=`1')

	      In addition to the MFE structure we print	a  coarse  representa-
	      tion of the pair probabilities in	form of	a pseudo bracket nota-
	      tion, followed by	the ensemble free energy, as well as the  cen-
	      troid  structure	derived	 from  the pair	probabilities together
	      with its free energy and distance	to the ensemble.   Finally  it
	      prints the frequency of the mfe structure.

	      An additionally passed value to this option changes the behavior
	      of partition function calculation: -p0 deactivates the  calcula-
	      tion  of	the  pair  probabilities, saving about 50% in runtime.
	      This prints the ensemble free energy -kT ln(Z).

       --MEA[=gamma]
	      Calculate	an MEA (maximum	expected  accuracy)  structure,	 where
	      the  expected  accuracy is computed from the pair	probabilities:
	      each base	pair (i,j) gets	a score	2*gamma*p_ij and the score  of
	      an  unpaired  base  is given by the probability of not forming a
	      pair.

	      (default=`1.')

	      The parameter gamma tunes	the importance of correctly  predicted
	      pairs versus unpaired bases. Thus, for small values of gamma the
	      MEA structure will contain only pairs with very  high  probabil-
	      ity.   Using  --MEA implies -p for computing the pair probabili-
	      ties.

       --mis  Output "most informative sequence" instead of simple  consensus:
	      For  each	 column	of the alignment output	the set	of nucleotides
	      with frequency greater than average in IUPAC notation.

	      (default=off)

       -s, --stochBT=INT
	      Stochastic backtrack. Compute a certain number of	random	struc-
	      tures  with  a  probability dependend on the partition function.
	      See -p option in RNAsubopt.

       --stochBT_en=INT
	      same as "-s" but also print out the energies  and	 probabilities
	      of the backtraced	structures.

       -N, --nonRedundant
	      Enable non-redundant sampling strategy.

	      (default=off)

       -S, --pfScale=scaling factor
	      In  the  calculation  of the pf use scale*mfe as an estimate for
	      the ensemble free	energy (used to	avoid overflows).

	      The default is 1.07, useful values are 1.0 to 1.2.  Occasionally
	      needed  for  long	sequences.  You	can also recompile the program
	      to use double precision (see the README file).

       -c, --circ
	      Assume a circular	(instead of linear) RNA	molecule.

	      (default=off)

       --bppmThreshold=<value>
	      Set the threshold	for base pair probabilities  included  in  the
	      postscript output

	      (default=`1e-6')

	      By  setting  the	threshold the base pair	probabilities that are
	      included in the output can be varied. By default only those  ex-
	      ceeding  1e-5 in probability will	be shown as squares in the dot
	      plot. Changing the threshold to any other	value allows  for  in-
	      crease or	decrease of data.

       -g, --gquad
	      Incoorporate  G-Quadruplex  formation into the structure predic-
	      tion algorithm.

	      (default=off)

       --sci  Compute the structure conservation index (SCI) for the MFE  con-
	      sensus structure of the alignment

	      (default=off)

   Model Details:
       -T, --temp=DOUBLE
	      Rescale energy parameters	to a temperature of temp C. Default is
	      37C.

       -4, --noTetra
	      Do not include special tabulated stabilizing energies for	 tri-,
	      tetra- and hexaloop hairpins.

	      (default=off)

	      Mostly for testing.

       -d, --dangles=INT
	      How  to  treat "dangling end" energies for bases adjacent	to he-
	      lices in free ends and multi-loops

	      (default=`2')

	      With -d2 dangling	energies will be added for the bases  adjacent
	      to a helix on both sides

	      in any case.

	      The  option -d0 ignores dangling ends altogether (mostly for de-
	      bugging).

       --noLP Produce structures without lonely	pairs (helices of length 1).

	      (default=off)

	      For partition function folding this only	disallows  pairs  that
	      can  only	occur isolated.	Other pairs may	still occasionally oc-
	      cur as helices of	length 1.

       --noGU Do not allow GU pairs

	      (default=off)

       --noClosingGU
	      Do not allow GU pairs at the end of helices

	      (default=off)

       --cfactor=DOUBLE
	      Set the weight of	the covariance term in the energy function

	      (default=`1.0')

       --nfactor=DOUBLE
	      Set the penalty for non-compatible sequences in  the  covariance
	      term of the energy function

	      (default=`1.0')

       -E, --endgaps
	      Score pairs with endgaps same as gap-gap pairs.

	      (default=off)

       -R, --ribosum_file=ribosumfile
	      use specified Ribosum Matrix instead of normal

       energy model. Matrixes to use should be 6x6
	      matrices,	the order of the terms is AU, CG, GC, GU, UA, UG.

       -r, --ribosum_scoring
	      use  ribosum  scoring  matrix. The matrix	is chosen according to
	      the minimal and maximal pairwise identities of the sequences  in
	      the file.

	      (default=off)

       --old  use old energy evaluation, treating gaps as characters.

	      (default=off)

       -P, --paramFile=paramfile
	      Read  energy parameters from paramfile, instead of using the de-
	      fault parameter set.

	      Different	sets of	energy parameters for RNA and DNA  should  ac-
	      company your distribution.  See the RNAlib documentation for de-
	      tails on the file	format.	When passing the placeholder file name
	      "DNA",  DNA  parameters  are loaded without the need to actually
	      specify any input	file.

       --nsp=STRING
	      Allow other pairs	in addition to the usual AU,GC,and GU pairs.

	      Its argument is a	comma separated	list of	 additionally  allowed
	      pairs.  If  the first character is a "-" then AB will imply that
	      AB and BA	are allowed pairs.  e.g. RNAfold -nsp -GA  will	 allow
	      GA and AG	pairs. Nonstandard pairs are given 0 stacking energy.

       -e, --energyModel=INT
	      Rarely used option to fold sequences from	the artificial ABCD...
	      alphabet,	where A	pairs B, C-D etc.  Use the  energy  parameters
	      for GC (-e 1) or AU (-e 2) pairs.

       --betaScale=DOUBLE
	      Set the scaling of the Boltzmann factors (default=`1.')

	      The  argument  provided  with  this  option enables to scale the
	      thermodynamic temperature	used in	the Boltzmann factors indepen-
	      dently  from the temperature used	to scale the individual	energy
	      contributions of the loop	types. The Boltzmann factors then  be-
	      come exp(-dG/(kTn*betaScale)) where k is the Boltzmann constant,
	      dG the free energy contribution of the  state,  T	 the  absolute
	      temperature and n	the number of sequences.

       Caveats:

       Sequences  are  not  weighted. If possible, do not mix very similar and
       dissimilar sequences. Duplicate sequences, for example, can distort the
       prediction.

REFERENCES
       If you use this program in your work you	might want to cite:

       R.  Lorenz,  S.H.  Bernhart,  C.	 Hoener	 zu Siederdissen, H. Tafer, C.
       Flamm, P.F. Stadler and I.L. Hofacker (2011), "ViennaRNA	Package	 2.0",
       Algorithms for Molecular	Biology: 6:26

       I.L.  Hofacker,	W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P.
       Schuster	(1994),	"Fast Folding and Comparison of	RNA  Secondary	Struc-
       tures", Monatshefte f. Chemie: 125, pp 167-188

       R.  Lorenz,  I.L. Hofacker, P.F.	Stadler	(2016),	"RNA folding with hard
       and soft	constraints", Algorithms for Molecular Biology 11:1 pp 1-13

       The algorithm is	a variant of the dynamic programming algorithms	of  M.
       Zuker and P. Stiegler (mfe) and J.S. McCaskill (pf) adapted for sets of
       aligned sequences with covariance information.

       Ivo L. Hofacker,	Martin Fekete, and Peter F. Stadler (2002), "Secondary
       Structure  Prediction  for Aligned RNA Sequences", J.Mol.Biol.: 319, pp
       1059-1066.

       Stephan H. Bernhart, Ivo	L. Hofacker, Sebastian Will, Andreas  R.  Gru-
       ber,  and  Peter	 F.  Stadler  (2008),  "RNAalifold: Improved consensus
       structure prediction for	RNA alignments", BMC Bioinformatics: 9,	pp 474

       The energy parameters are taken from:

       D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J.	Schroeder,  J.
       Susan,  M. Zuker, D.H. Turner (2004), "Incorporating chemical modifica-
       tion constraints	into a dynamic programming algorithm for prediction of
       RNA secondary structure", Proc. Natl. Acad. Sci.	USA: 101, pp 7287-7292

       D.H  Turner, D.H. Mathews (2009), "NNDB:	The nearest neighbor parameter
       database	for predicting stability of nucleic acid secondary structure",
       Nucleic Acids Research: 38, pp 280-282

EXAMPLES
       A simple	call to	compute	consensus MFE structure, ensemble free energy,
       base pair probabilities,	centroid structure, and	MEA  structure	for  a
       multiple	 sequence alignment (MSA) provided as Stockholm	formatted file
       alignment.stk might look	like:

	 $ RNAalifold -p --MEA alignment.stk

       Consider	the following MSA file for three sequences

	 # STOCKHOLM 1.0

	 #=GF AC   RF01293
	 #=GF ID   ACA59
	 #=GF DE   Small nucleolar RNA ACA59
	 #=GF AU   Wilkinson A
	 #=GF SE   Predicted; WAR; Wilkinson A
	 #=GF SS   Predicted; WAR; Wilkinson A
	 #=GF GA   43.00
	 #=GF TC   44.90
	 #=GF NC   40.30
	 #=GF TP   Gene; snRNA;	snoRNA;	HACA-box;
	 #=GF BM   cmbuild -F CM SEED
	 #=GF CB   cmcalibrate --mpi CM
	 #=GF SM   cmsearch --cpu 4 --verbose --nohmmonly -E 1000 -Z 549862.597050 CM SEQDB
	 #=GF DR   snoRNABase; ACA59;
	 #=GF DR   SO; 0001263;	ncRNA_gene;
	 #=GF DR   GO; 0006396;	RNA processing;
	 #=GF DR   GO; 0005730;	nucleolus;
	 #=GF RN   [1]
	 #=GF RM   15199136
	 #=GF RT   Human box H/ACA pseudouridylation guide RNA machinery.
	 #=GF RA   Kiss	AM, Jady BE, Bertrand E, Kiss T
	 #=GF RL   Mol Cell Biol. 2004;24:5797-5807.
	 #=GF WK   Small_nucleolar_RNA
	 #=GF SQ   3

	 AL031296.1/85969-86120	    CUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUAACAAUACUUACUCUCGUUGGUGAUAAGGAACAGCU
	 AANU01225121.1/438-603	    CUGCCUCACAACAUUUGUGCCUCAGUUACUCAUAGAUGUAGUGAGGGUGACAAUACUUACUCUCGUUGGUGAUAAGGAACAGCU
	 AAWR02037329.1/29294-29150 ---CUCGACACCACU---GCCUCGGUUACCCAUCGGUGCAGUGCGGGUAGUAGUACCAAUGCUAAUUAGUUGUGAGGACCAACU
	 #=GC SS_cons		    -----((((,<<<<<<<<<___________>>>>>>>>>,,,,<<<<<<<______>>>>>>>,,,,,))))::::::::::::
	 #=GC RF		    CUGCcccaCAaCacuuguGCCUCaGUUACcCauagguGuAGUGaGgGuggcAaUACccaCcCucgUUgGuggUaAGGAaCAgCU
	 //

       Then, the above program call will produce this output:

	 3 sequences; length of	alignment 84.
	 >ACA59
	 CUGCCUCACAACAUUUGUGCCUCAGUUACCCAUAGAUGUAGUGAGGGUAACAAUACUUACUCUCGUUGGUGAUAAGGAACAGCU
	 ...((((((.(((((((((...........))))))))).))))))..........(((((......)))))............ (-12.54 =	-12.77 +   0.23)
	 ...((((((.(((((((((...........))))))))).)))))){{,.......{{{{,......}))))............ [-14.38]
	 ...((((((.(((((((((...........))))))))).))))))..........((((........))))............ {-12.44 =	-12.33 +  -0.10	d=10.94}
	 ...((((((.(((((((((...........))))))))).))))))..........((((........))))............ {-12.44 =	-12.33 +  -0.10	MEA=66.65}
	  frequency of mfe structure in	ensemble 0.368739; ensemble diversity 17.77

       Here, the first line is written to stderr and simply states the	number
       of  sequences  and  the	length of the alignment. This line can be sup-
       pressed using the --quiet option.  The main output then consists	 of  7
       lines,  where  the  first  two resemble the FASTA header	with the ID as
       read from the input data	set, followed by the consensus sequence	in the
       second  line. The third line consists of	the consensus secondary	struc-
       ture in dot-bracket notation followed by	the averaged minimum free  en-
       ergy  in	 parenthesis.  This  energy is composed	of two major contribu-
       tions, the actual free  energies	 derived  from	the  Nearest  Neighbor
       model,  and the covariance pseudo-energy	term, which are	both displayed
       after the equal sign. The fourth	line shows the base pair propensity in
       pseudo  dot-bracket  notation followed by the ensemble free energy dG =
       -kT ln(Z) in square brackets.  Similarly, the next two lines state  the
       controid-  and  the  MEA	structure in dot-bracket notation, followed by
       their corresponding free	energy contributions, the mean distance	(d) to
       the ensemble as well as the maximum expected accuracy (MEA). Again, the
       free energies are split into Nearest Neighbor contribution and the  co-
       variance	pseudo-energy term.

       Furthermore,  RNAalifold	 will produce three output files: ACA59_ss.ps,
       ACA59_dp.ps, and	ACA59_ali.out that  contain  the  secondary  structure
       drawing,	 the  base  pair probability dot-plot, and a detailed table of
       base pair probabilities,	respectively.

THE ALIOUT FILE
       When computing base pair	probabilities (--partfunc option),  RNAalifold
       will  produce  a	file with the suffix `ali.out`.	This file contains the
       base pairing probabilities between different alignment columns together
       with  some  detailed statistics for the individual sequences within the
       alignment. The file is a	simple text file with a	two line  header  that
       states  the  number of sequences	and length of the alignment. The first
       couple of lines of this file may	look like:

	 3 sequence; length of alignment 84
	 alifold output
	    14	  36  0	 92.7%	 0.212 CG:1    UA:2
	    13	  37  0	 92.7%	 0.218 GU:1    AU:2
	    12	  38  0	 92.7%	 0.231 CG:3
	    15	  35  0	 91.9%	 0.239 UG:3
	    16	  34  0	 85.2%	 0.434 UA:2    --:1
	     8	  42  0	 80.7%	 0.526 AU:3   +
	     9	  41  0	 80.4%	 0.542 CG:3   +
	     7	  43  1	 80.1%	 0.541 CG:2   +

       Starting	with the third row, there are at least six and at most 13 col-
       umns  separated	by whitespaces stating:	(1) the	i-position and (2) the
       j-position of a potential base pair (i, j), followed by (3) the	number
       of counter examples, i.e. the number of sequences in the	alignment that
       can't form a canonical base pair	with their respective  sequence	 posi-
       tions.  Next is (4) the base pair probabilitiy in percent, (5) a	pseudo
       entropy measure S_ij = S_i + S_j	- p_ij ln(p_ij), where S_i and S_j are
       the  positional	entropies  for	the two	alignment columns i and	j, and
       p_ij is the base	pair probability. Finally,  the	 last  columns	(6-12)
       state  the number of particular base pairs for the individual sequences
       in   the	  alignment.   Here,   we   distinguish	  the	 base	 pairs
       "GC","CG","AU","UA","GU","UG",  and  the	 special case "--" that	repre-
       sents gaps at both positions i and j.  Finally, base pairs that are not
       part  of	 the MFE structure are marked by an additional "+" sign	in the
       last column.

AUTHOR
       Ivo L Hofacker, Stephan Bernhart, Ronny Lorenz

REPORTING BUGS
       If in doubt our program is right, nature	is at fault.  Comments	should
       be sent to rna@tbi.univie.ac.at.

SEE ALSO
       The ALIDOT package http://www.tbi.univie.ac.at/RNA/Alidot/

RNAalifold 2.4.14		  August 2019			 RNAALIFOLD(1)

NAME | SYNOPSIS | DESCRIPTION | REFERENCES | EXAMPLES | THE ALIOUT FILE | AUTHOR | REPORTING BUGS | SEE ALSO

Want to link to this manual page? Use this URL:
<https://www.freebsd.org/cgi/man.cgi?query=RNAalifold&sektion=1&manpath=FreeBSD+12.2-RELEASE+and+Ports>

home | help